Glycobiology, 2001, Vol. 11, No. 6 459-471
© 2001 Oxford University Press
In vivo glycosylation of mucin tandem repeats
2Paediatric Molecular Genetics, Institute of Molecular Medicine, University of Oxford, John Radcliffe Hospital, Oxford, OX3 9DS, UK, 3Department of Biochemistry, Imperial College of Science, Technology and Medicine, South Kensington, London SW7 2AZ, UK, 4Eppley Institute, University of Nebraska Medical Center, Omaha NE, 68198-6805, USA, and 5Department of Biochemistry, University of Nebraska Medical Center, Omaha NE, 68198-6805, USA
Received on November 10, 2000; revised on January 23, 2001; accepted on January 29, 2001.
| Abstract |
|---|
|
|
|---|
The biochemical and biophysical properties of mucins are largely determined by extensive O-glycosylation of serine- and threonine-rich tandem repeat (TR) domains. In a number of human diseases aberrant O-glycosylation is associated with variations in the properties of the cell surfaceassociated and secreted mucins. To evaluate in vivo the O-glycosylation of mucin TR domains, we generated recombinant chimeric mucins with TR sequences from MUC2, MUC4, MUC5AC, or MUC5B, which were substituted for the native TRs of epitope-tagged MUC1 protein (MUC1F). These hybrid mucins were extensively O-glycosylated and showed the expected association with the cell surface and release into culture media. The presence of different TR domains within the chimeric mucins appears to have limited influence on their posttranslational processing. Alterations in glycosylation were detailed by fast atom bombardment mass spectrometry and reactivity with antibodies against particular blood-group and tumor-associated carbohydrate antigens. Future applications of these chimeras will include investigations of mucin posttranslational modification in the context of disease.
Key words: glycosylation/mucin/tandem repeat/in vivo
| Introduction |
|---|
|
|
|---|
Extensive O-glycosylation of mucin tandem repeat (TR) domains is thought to play an important role in determining the biochemical and biophysical properties of these high molecular weight glycoproteins. Variations in the properties of the cell surfaceassociated and secreted mucins have been associated with aberrant O-glycosylation in cystic fibrosis, ulcerative colitis, inflammatory bowel disease. and some cancers (Boat et al., 1989
Partial or full-length cDNAs for 12 mucin-like proteins have been identified in human epithelia. Extensive variation exists in sequence, length, and number of tandemly arrayed units among mucin TR domains. This has led to the hypothesis that primary sequence and higher-order structures conferred by the arrangement of the tandem arrays contribute to both the extent and type of glycosylation. However, the size of fully processed mucins (150 to
7000 kDa) and the diversity of carbohydrate structures present on them, has made it difficult to investigate many aspects of the molecular features of mucin glycosylation. Analyses of mucins purified from cystic fibrosis patients have identified alterations in glycosylation, sialylation, and sulfation (Cheng et al., 1989
; Thornton et al., 1991a
,b; Carnoy et al., 1993
; Zhang et al., 1995
; Thomsson et al., 1998
). Nonetheless, bulk mucin preparations from patients are comprised of secretions from multiple organ and cell types, and their analyses are complicated by secondary modifications that result from bacterial infection, disease pathology, and variations in sample preparation. Attempts to circumvent these difficulties, by analyzing the O-glycosylation of synthetic peptides in vitro (O'Connell et al., 1991
; Wang et al., 1992
, 1993) and the processing of mucin-type glycoproteins in vivo (Nehrke et al., 1996
; Pisano et al., 1993
, 1994) have been helpful, but these studies fail to provide information on the molecular detail of O-glycosylation of different mucins. For example, the influence of primary sequence of mucin TRs may be an important determinant in the processing and maturation of mucins (Litvinov and Hilkens, 1993
; Muller et al., 1997
).
The aim of this study was to evaluate the influence of the amino acid (aa) sequence of different mucin TR domains on their posttranslational processing in vivo. Because it has been impossible to assemble full-length constructs for most mucins, we elected to express different mucin TRs in the context of a common mucin protein that has been characterized previously (MUC1). To this end, we generated constructs in which TR domains from a specific mucin were substituted for the native TRs of an epitope-tagged MUC1 cDNA (MUC1F) (Burdick et al., 1997
). A series of chimeric mucins containing TRs from MUC2 (83 aas), MUC4 (173 aas), MUC5AC (138 aas), and MUC5B (170 aas) were created. Here we show that these hybrid mucins are extensively O-glycosylated, associated with the cell surface, and released from epithelial cells into the culture medium. Analysis of O-glycosylation of the chimeric mucins, by mass spectrometry and by their reactivity with antibodies against particular blood-group and tumor-associated carbohydrate antigens, suggests that both common and distinct carbohydrates are attached to the substituted TR domains. This finding supports the hypothesis that the amino acid sequence of mucin TRs contributes to their O-glycosylation in vivo.
| Results |
|---|
|
|
|---|
Four chimeric mucins were generated in which the TR domain of MUC1F (Burdick et al., 1997
TR) (Table IAC) (Hansen et al., 1995
|
|
Expression of chimeric mucins
Expression of chimeric mucins was controlled by the human ß-actin promoter (pHß-Apr-1-neo vector). The constructs were transfected into the human colon adenocarcinoma cell line Caco2, and clones exhibiting stable integration of the plasmid were selected by culture in G418. For each chimeric construct one representative clone was selected, and epitope-tagged mucin was immunoprecipitated. Western blot analysis using M2 anti-FLAG antibody indicated the presence of glycoforms with apparent molecular weights of approximately: > 250, 200, and 120 kDa for MUC1F; 80 kDa for MUC1F(
TR); 120 kDa for MUC1F/2TR; 180 kDa for MUC1F/5ACTR; 250 kDa for MUC1F/5BTR; and 250 kDa for MUC1F/4TR (Figure 2, Table IA). The observed mobility of the chimeric mucins in SDSpolyacrylamide gel electrophoresis (PAGE), relative to the molecular weights predicted for the recombinant proteins, suggests they are highly glycosylated (Table IA).
|
Processing of chimeric mucins
During normal processing of MUC1, cleavage of the full-length protein generates a cell surfaceassociated heterodimer consisting of the transmembrane/cytoplasmic tail and an extended extracellular component containing the TR domain (Metzgar et al., 1982
TR), and the chimeric mucins confirmed cell-surface expression of the FLAG epitope on each of the constructs examined (Figure 3).
|
Figure 4 shows evidence for release of the extracellular domain of each chimeric mucin into cell culture medium. In Figure 4A, Western blots of M2-immunoprecipitated material from whole cell lysates and from conditioned cell culture media were probed with M2 antibody to detect chimeric mucins secreted into the cell culture medium. Additional fast-migrating species as seen in MUC1F/4TR (Figure 4A) may either be due to incompletely processed forms of the glycoprotein or those carrying a different charge. Release of the MUC1 extracellular domain from the cell surface depends on disassociation of the heterodimer from the cytoplasmic tail. It is also possible that living or dead Caco2 adenocarcinoma cells shed some cell surface membranebound material as small vesicles, which may contain membrane-associated MUC1. To address this, equivalent Western blots were probed with CT-1, an antibody that is specific for the cytoplasmic tail of the MUC1 protein (Pemberton et al., 1992
|
O-glycosylation of chimeric mucins
Epitope-tagged mucins immunoprecipitated with M2 were evaluated for the presence of carbohydrate structures by Western blotting followed by analysis with digoxigenin-labeled lectins and a panel of antibodies against tumor-associated and blood-group carbohydrate antigens (Table II). Reactivity of the lectin Maackia amurensis agglutinin (MAA) revealed the presence of NeuAc
2,3Gal on each of the epitope-tagged mucins, including MUC1F(
TR) (data not shown). The lectin Sambucus nigra agglutinin (SNA), which recognizes NeuAc
2,6Gal, was not reactive with any of the chimeric mucins or MUC1F or MUC1F(
TR) (data not shown).
|
Twelve antibodies against tumor-associated or blood-group carbohydrate antigens were used for analysis of the chimeric mucins (Table II). Duplicate Western blots were probed with M2 to ensure that adequate levels of each chimeric mucin were present on the western blots prior to evaluation of antibody reactivity (not shown). Five of the 12 antibodies were reactive with MUC1F: B67.4 (detecting sialyl Lea [
2-3]) was weakly reactive, GSLA2 (also detecting sialyl Lea [
2-3]), B32.4 (detecting Ley), CC49 (detecting
2,6 mono sialyl T and sialyl Tn) and B230.1 (detecting Tri-Tn) (Table II). Antibodies against Lea (C0514), Leb (C0431), sialyl Lec (Dupan2), Lex (B93.1), sialyl Lex (CSLEX1), and sialyl Tn (B72.3) were not reactive (Table II). These data are consistent with those reported previously for MUC1F expressed in Caco2 cells (Reid et al., 1999
2-3]), GSLA2 (sialyl Lea [
2-3]), and B230.1 (Tri-Tn), were also present on MUC1F/4TR (Table II), but were not identified on MUC1F(
TR) or the chimeric mucins. The B32.4 (Ley) antibody was reactive with MUC1F/4TR and weakly reactive with MUC1F, MUC1F/5ACTR, and MUC1F/5BTR (Table II and data not shown).
Positive controls for antibody reactivity included MUC1F in Caco2 or MUC1F in HT29 clones, where appropriate (Reid et al., 1999
). To control for nonspecific interactions of M2-agarose beads with other glycoproteins in the cell extracts, immunoprecipitated material from N30, a pHß-APr1-neo vector control transfected cell line (Reid et al., 1999
), was evaluated for reactivity. No reactivity was observed in M2 immunoprecipitates from N30, with MAA lectin, or any of the anticarbohydrate antibodies that were reactive with MUC1F, MUC1F(
TR) and the chimeric mucins (Table II).
Mass spectrometric analysis strategy
O-linked oligosaccharides were released from the immunoprecipitated mucins by reductive elimination. Traces of residual detergent were removed by purification on Sep-Pak C18 cartridges before the O-glycans were prepared as permethylated derivatives. These derivatives were characterized by fast atom bombardment mass spectrometry (FAB-MS) and by electron impact gas chromatography mass spectrometry (EI GC-MS) linkage analysis of their corresponding partially methylated alditol acetates. To obtain further structural information on the sequence and O-glycan core type of the oligosaccharides, mild periodate oxidation was used to selectively oxidize the C4C5 bond of 3- and 3,6-substituted GalNAcitol (Stoll et al., 1990
). The reduced products of periodate oxidation were permethylated and analyzed by FAB-MS. Because only limited amounts of mucin were available, the oligosaccharides were always analyzed as a mixture. Structural predictions were based on molecular weight, linkage data, and the periodate fragmentation of the oligosaccharides. Each of the chimeric mucins has been analyzed by FAB-MS three to five times from lysates prepared from individual clones on separate occasions. In all samples where the quality of the data indicated good release of glycans during the reductive elimination the results were reproducible. One exception was the MUC1F/5BTR clone, which showed additional glycans on one occasion.
FAB-MS of methylated products of reductive elimination
The FAB-MS spectra of the permethylated products of reductive elimination are shown in Figure 5, and the assignment of these ions is given in Table III. The assignments for MUC1F were confirmed by observing mass shifts after deuteromethylation (data not shown). Pseudomolecular ions corresponding to the molecular weight of known O-glycan structures were observed for each mucin, including MUC1F(
TR) (Figure 5A). No molecular ions were afforded by any derivative when analyzed in the mass range greater than m/z 2000, suggesting that the O-glycans present on the epitope-tagged mucins are relatively short structures or that longer structures are in very low abundance.
|
|
The oligosaccharide compositions in Table III suggests the presence of two families of O-glycans. Members of the first family have compositions of Hex1HexNAc1-ol, Fuc1Hex1HexNAc1-ol, NeuAc1Hex1HexNAc1-ol, and NeuAc2Hex1HexNAc1-ol, which are consistent with type 1 core structures. Members of the second family of pseudomolecular ions have compositions Hex1HexNAc2-ol, Hex2HexNAc2-ol, Fuc1Hex2HexNAc2-ol, NeuAc1Hex2HexNAc2-ol, Hex3HexNAc3-ol, NeuAc1Fuc1Hex2HexNAc2-ol, and NeuAc2Hex2HexNAc2-ol, which indicate that other core structures may be present. The predominant structure in this family is m/z 983 (e.g., Figure 5B) which corresponds to Hex2HexNAc2-ol, a composition that precludes a core 4 structure. Mono- and disialyl variations of this composition occur at m/z 1344 and m/z 1705, as well as a fucosylated non- and mono-sialyl variation at m/z 1157 and m/z 1518, respectively. In the FAB-MS spectrum of MUC1F an A-type fragment ion at m/z 825 (NeuAc1Hex1HexNAc1+) (Figure 5B) is present, indicating that the NeuAc1Hex1HexNAc1 sequence occurs in the sialylated oligosaccharides, such as m/z 1344 and m/z 1705.
Mild periodate oxidation of the 3-GalNAcitol and 3,6-GalNAcitol in the MUC1F oligosaccharides was expected to cleave specifically between carbons 4 and 5. On further reduction this would result in separate molecules containing carbohydrate sequences linked to either the third or the sixth carbon of the cleaved GalNAcitol, which consequently serves as a reducing end tag denoted as C4 and C2, respectively. The FAB spectrum of periodate oxidized MUC1F (Figure 6) is dominated by a signal at m/z 562 corresponding to Hex1HexNAc1-C2. Furthermore, a significant signal corresponding to Hex1-C4 (m/z 446) is observed and no detectable levels of HexNAc1-C4 are present. If the dominance of the signals corresponding to Hex1HexNAc1-ol (m/z 534) and Hex2HexNAc2-ol (m/z 983) present in the FAB-MS spectrum of MUC1F (Figure 5B) are taken into consideration with these periodate data, then we can conclude that the classes of O-glycans that occur are cores 1 and 2. The reasoning behind this is that Hex1Hex1HexNAc1-C4 and Hex1Hex1HexNAc1-C2 sequences are not observed but would be predicted to be present if Hex2HexNAc2-ol was core 3, 5, 6, or 7. Although the possibility of core 8 can not be excluded, this is unlikely because it is a rare structure that has been reported to occur only as a di- or trisaccharide that is present in low abundance (van Halbeek et al., 1994
; Martensson et al., 1998
). In addition to the GalNAcitol cleavage, a cleavage between carbons 7 and 8 and/or carbons 8 and 9 was expected to occur in neuraminic acid residues. Concordant with this prediction, signals with a composition of NeuAc1Hex1-C4 (m/z 719) and NeuAc1Hex1HexNAc1-C2 (m/z 835) were observed. This is consistent with cleavage between carbons 7 and 8 of neuraminic acid and carbons 4 and 5 of GalNAcitol of core 1 or 2 structures with neuraminic acid present on either antenna. As the conditions used for periodate oxidation released fucose residues, no molecular ions corresponding to fucosylated fragments were observed. The absence of an observable signal corresponding to Hex1HexNAc1Hex-C4 indicates lack of elongation of the core 1 antenna.
|
GC-MS linkage analysis of the methylated products of reductive elimination.
The results of the GC-MS linkage analysis for MUC1F are shown (Table IV). The chimeric mucin species gave similar data except for species that were very low in abundance. Detectable levels of 3- and 3,6-GalNAcitol were only observed in MUC1F, MUCF/4TR, and MUC1F/5ACTR, and detectable levels of some species were only observed in MUC1F (3,4-GlcNAc, 6-Gal, and t-GlcNAc). Linkage analysis on the permethyl derivatives of each chimeric mucin yielded 3-GalNAcitol and 3,6-GalNAcitol, consistent with core 1 and core 2 structures predicted from the mild periodate oxidation of MUC1F. One of the most striking features of the linkage data is the high abundance of 3-Gal relative to 6-Gal, indicating that the sialic acid is predominately linked in a NeuAc
2-3Gal linkage rather than a NeuAc
2-6Gal linkage. Another significant feature is the presence of a peak corresponding to 4-GlcNAc without detectable levels of 3-GlcNAc. This indicates that lactosamine sequences in those oligosaccharides whose lactosamine moieties are unsubstituted on the GlcNAc, are all of the "type 2 lactosamine" classification. The presence of major terminal galactose is consistent with most oligosaccharides having galactose at their nonreducing ends. The presence of 2-Gal, 3,4-GlcNAc and terminal fucose are in accordance with the fucosylated epitopes of blood group H and Lewis structures.
|
| Discussion |
|---|
|
|
|---|
The O-glycosylation of mucins, primarily within TRs, is a major factor that determines their biochemical and biophysical properties. Our aim was to develop a system to analyze the O-glycosylation of TRs from different mucins. Most mucins cloned to date exhibit very high molecular weights and are difficult to purify and study due to their size and biochemical properties. We generated chimeric mucins in which the TR of an epitope-tagged MUC1 has been replaced by TR segments from either MUC2, MUC4, MUC5AC, or MUC5B. These were stably transfected into the Caco2 colon carcinoma cell line and shown to yield glycosylated molecules that were both cell surfaceassociated and secreted into the cell culture medium.
To evaluate whether these mucins will prove useful for investigating O-glycosylation in a variety of cellular expression systems, we analyzed the carbohydrate structures attached to the chimeric glycoproteins. We compared carbohydrates structures on the chimeric mucins with those seen on MUC1F in the same cell line. To assess the presence of structures on O-glycosylation sites outside the substituted TR domains we also evaluated a MUC1F construct that lacks the endogenous MUC1 TR sequence (MUC1F(
TR)).
In these experiments we have selected for analysis one clone expressing high levels of each of the chimeric mucins. It is possible that variations in O-glycosylation between different clones carrying the same chimeric mucin might affect the interpretation of our data. In previous analyses of multiple Caco2 clones expressing MUC1F (Reid et al., 1999
) little clonal variation was observed in the reactivity of MUC1F to antibodies against certain blood group and tumor-associated antigens. Furthermore, analyses of three clones expressing MUC1F/4TR revealed no evidence of gross differences in O-glycosylation between different clones, as assessed by their mobility on Western blots or their FAB-MS spectra (data not shown).
Using antibodies against known blood-group and tumor-associated carbohydrate antigens it was previously established that MUC1F expressed in Caco2 often carried sialyl Lewisx (CSLEX), usually carried sialyl Lewisa (B67.4) and always
2,6 mono sialyl T or sialyl Tn (CC49) (Reid et al., 1999
). Among the chimeric mucins expressed in Caco2, only MUC1F/4TR showed reactivity with B67.4 and GSLA2, a second antibody specific for sialyl Lewisa. In addition, Tri-Tn (B230.1) was detected on MUC1F and MUC1F/4TR, while low levels of Ley (B32.4) were detected on MUC1F, MUC1F/4TR, MUC1F/5ACTR, and MUC1F/5BTR.
The carbohydrate structures carried on the chimeric mucins were found to differ in the clones analysed, suggesting that the TR domain may contribute to the specificity of O-glycosylation. It appears that the MUC1F/4TR chimera carries most (but not all) of the structures seen on the full-length MUC1F in Caco2 cells. With the exception of weak reactivity with B32.4 (Ley) in MUC1F/5ACTR and MUC1F/5BTR, the remainder of the chimeric mucins do not carry structures detected by this series of antibodies. It is possible that the antibodies utilized here interact with patches of O-linked carbohydrates, which result from the primary sequence of the TRs, that may not be generated in the chimeras. The limited length of the TR sequences in the chimeras in comparison to their respective full-length TRs may also contribute to the lack of reactivity of some antibodies.
Structural conclusions
Taking into account the data from the FAB-MS screening experiments, periodate oxidation of MUC1F and linkage analysis, we conclude that core 1 and core 2 O-glycan structures are present on these chimeric mucins. A number of these are sialylated predominantly in a NeuAc
2-3Gal linkage that may be present on either or both antennae. Periodate cleavage data suggest that the 3-antennae are not elongated in either core 1 and core 2 structures. Some fucosylation is also present (see molecular ions at m/z 708, 1157, and 1518, Figure 5). From linkage data, fucose is predicted to occur on a galactose residue in a blood group H type structure (2-linked Gal, Table IV) and as a Lewis structure (3,4-linked GlcNAc, Table IV). The molecular ion at m/z 1518 (Figure 5) is consistent with a sialylated, fucosylated glycan. Because of its low abundance, an unambiguous structure could not be defined for this glycan but likely possibilities, considering both MS and antibody data, are given in Table V. Finally, the linkage data suggest that lactosamine moieties which are unsubstituted on GlcNAc are likely to be exclusively of the "type 2" classification (Galß1-4GlcNAc). However, potential Lewis structures are insufficiently abundant to allow firm conclusions regarding the presence or absence of the "type 1" (Galß1-3GlcNAc) backbone. The structural predictions based on these data are depicted in Table V.
|
Comparisons between chimeric mucins
Comparisons between the MUC1F(
TR) (Figure 5A) and MUC1F (Figure 5B) spectra reveal that several O-glycans are present on MUC1F, which are not present on MUC1F(
TR). For example, the pseudomolecular ion at m/z 708, corresponding to Fuc1Hex1HexNAc1-ol, is absent from the MUC1F(
TR) spectrum. The ion at m/z 1705 is also absent, but this could be due to the lower abundance of glycans on MUC1F(
TR). The higher intensity of the pseudomolecular ions and the presence of additional structures on MUC1F, suggests the TRs of MUC1F are glycosylated. The glycan at m/z 779 has the composition of Hex1HexNAc2-ol and is found on each of the epitope-tagged mucins. The family to which this oligosaccharide belongs is uncertain, as linkage and periodate data can support both core types 1 and 2. Conversely, there are some pseudomolecular ions that are unique to certain spectra. Most notably, the ion at m/z 1256 (corresponding to NeuAc2Hex1HexNAc1-ol) is abundant in the MUC1F/5ACTR (Figure 5E) and MUC1F/5BTR (Figure 5F) spectra, but not in any of the others. Similarly, the pseudomolecular ion at m/z 1432 (corresponding to Hex3HexNAc3-ol) is only present in the MUC1F/4TR spectrum (Figure 5D).
Not only are there differences in the O-glycans present on the mucins, there is also an apparent variability in the relative amounts of the glycans that are common to all. For example, within a given FAB spectrum pseudomolecular ions, such as m/z 534 (Hex1HexNAc1-ol) and m/z 983 (Hex2HexNAc2-ol), vary considerably in relative intensity to the background and to other signals. The MUC1F(
TR) m/z 534 signal is barely distinguishable from the background (Figure 5A), whereas the m/z 534 signal in the FAB spectra of MUC1F/2TR (Figure 5C), MUC1F/4TR (Figure 5D), MUC1F/5ACTR (Figure 5E), and MUC1F/5BTR (Figure 5F) is the predominant signal. Interestingly, though m/z 534 and m/z 983 are predominant signals in each FAB spectrum, only in the MUC1F (Figure 5B) spectrum is the signal at m/z 983 more dominant.
Attachment of glycans to MUC1F(
TR) indicates that some glycosylation occurs outside the TRs of MUC1. The intensity of the MUC1F(
TR) O-glycan ions relative to the background is lower than those in the other constructs despite similar amounts of starting material, suggesting that there is relatively low O-glycosylation of MUC1F(
TR) as compared to constructs containing TRs. Nonetheless, this confirms that the region outside the TRs in MUC1F and the chimeric constructs are glycosylated at low levels.
A comparison of carbohydrate structures detected by FAB-MS and by using antibodies to known carbohydrate epitopes is of interest. MUC1F showed reactivity to the antibody CC49, which reacts with
2,6mono sialyl T and sialyl Tn (Beum et al., 1999
), though not with B72.3, which detects the sialyl Tn epitope alone. Though no definitive evidence for sialyl Tn structures was obtained from the FAB-MS data, the pseudomolecular ion at m/z 895 corresponds to the sialyl T family. Taken together, the FAB-MS and antibody results are consistent and suggest that the reactivity of antibody CC49 with MUC1F is directed to a
2,6mono sialyl T epitope and that there is no sialyl Tn detected on MUC1F expressed in Caco2.
Although very weak signals were observed in some spectra at masses consistent with difucosylated compositions, no definitive evidence for Ley structures was obtained by FAB-MS. However, the B32.4 antibody, which is specific for this structure, showed weak reactivity with MUC1F, MUC1F/5ACTR, MUC1F/5BTR, and MUC1F/4TR. These data are consistent with the relatively limited ability of FAB-MS to detect very low abundance structures.
MUC1F and MUC1F/4TR were also reactive with two antibodies specific for sialyl Lea (B67.4 and GSLA2). The FAB-MS data do not provide conclusive evidence to distinguish between sialyl Lea and sialyl Lex structures as the pseudomolecular ion at m/z 1518 might represent either structure. However, because the CSLEX antibody, which is specific for sialyl Lex, shows no reactivity with MUC1F or the chimeric mucins, sialyl Lea is the more probable structure.
The lack of sialyl Lec structures (also called LSTA and which is similar to sialyl Lewisa but lacks the fucose residue) and of reactivity with Dupan2 on these mucins is consistent with previous observations that colon carcinoma cell lines do not produce these structures, which are highly represented on MUC1 produced by pancreatic adenocarcinomas (Burdick et al., 1997
; Reid et al., 1999
).
It is of interest that MUC1F in Caco2 contained epitopes detected by the CC49 antibody, but showed no reactivity with CSLEX. The sialyl transferases ST6GalNAc I (Ikehara et al., 1999
) and II compete with the core 2 GlcNAc-transferase for the core 1 acceptor substrate (Kurosawa et al., 1994a
,b). As mentioned above, CC49 is known to react with simple core structures lacking the core 2 branch, such as NeuAc
2,6-(Galß1,3)GalNAc and NeuAc
2,6GalNAc (Hanisch et al., 1989
; O'Boyle et al., 1996
). Overexpression of the core 2 ß-1,6-N-acetylglucosaminyl transferase in a pancreatic cancer cell line has been shown to diminish the expression of the CC49 epitope and increase the expression of the CSLEX epitope which is an important selectin ligand (Beum et al., 1999
). Although core 2 structures were observed in addition to core 1 structures on MUC1F by MS, the antibody data suggest that the core 2 structures did not include detectable amounts of sialyl Lewisx in the Caco2 cells analyzed here. Minimal, barely detectable amounts of sialyl Lewisx were sometimes observed on MUC1 produced by Caco2 cells in past analyses (Burdick et al., 1997
; Reid et al., 1999
). This confirms that regulation of glycosyltransferases in addition to the core 2 ß-1,6-N-acetylglucosaminyl transferase are necessary to produce high levels of sialyl Lewisx structures on MUC1 produced by other colon tumor cell lines, such as HT29 (Burdick et al., 1997
; Reid et al., 1999
). The paucity of sialyl Lewis x seen in the Caco2 carcinoma cell lines is consistent with their low spontaneous metastatic potential.
Due to their size and complexity, only limited information is available on higher-order O-glycan structures on native MUC4, MUC5AC, and MUC5B (Rose, 1992
; Hennebicq et al., 1998
; Soudan et al., 1998
). Some data have been derived from analyses of TR peptides glycosylated in vitro, however, such results, as has been shown for MUC1F peptides (Muller et al., 1999
), may not reflect the state of mucin glycosylation in vivo. These chimeric mucins represent an alternative resource for investigating the site-specific posttranslational modification of mucins in normal cells and in the context of disease.
There are additional applications for the chimeric mucins. The chimeric constructs may be expressed in epithelial cells derived from airway, pancreatic, renal, or other epithelia. This will allow analysis of cell typespecific variation in mucin O-glycosylation. Aberrant expression of mucins may be associated with cancer cells and their metastasis, hence, the potential role of the mucin TR in tumor growth and migration may be evaluated in vivo. Cell-surface and secreted mucins are involved in cellcell interactions and in adhesion/anti-adhesion of pathogens, such as bacteria, to the epithelial cell surface. Epithelial cells transfected with the chimeric mucins will be a valuable resource for addressing these processes.
| Materials and methods |
|---|
|
|
|---|
Generation of epitope-tagged chimeric MUC1 constructs
The epitope-tagged (FLAG) MUC1 cDNA (MUC1F) and a construct lacking the TR domain (MUC1F(
TR)) were described previously (Burdick et al., 1997
To generate the MUC2 chimera (MUC1F/2TR), the region of the MUC1 cDNA encoding the TR domain was removed by digestion with BsmI and EcoNI. A 249-bp FokINciI fragment of MUC2 derived from clone SMUC41 (GenBank L21998:1264512891)(Gum et al., 1994
) was ligated into the remaining MUC1 sequence with an oligonucleotide linker (5'-CAGCAG-3'). The epitope tag was added to this construct as previously described for MUC1F (Burdick et al., 1997
) to generate MUC1F/2TR. The SMUC41 clone was kindly donated by Dr. J. Gum.
Insertion of the FLAG sequence into MUC1F(
TR) (Burdick et al., 1997
) created two unique restriction enzyme sites, BglII and AspI, immediately adjacent to the epitope. These two sites were used for generating the following chimeric mucins.
The MUC4 chimera (MUC1F/4TR) includes a 519-bp EcoRI fragment of the MUC4 partial cDNA clone DUM4.4 (Genbank AF177925:1486). This EcoRI fragment was cloned into a pBluescript (SK) vector, which contains a modified multiple cloning site consisting of an adaptor duplex complementary to KpnI and SacI restriction sites (5' CCCGAGATCTCGAATTCGACATGGTCGGTAC 3'). This cDNA was excised with BglII and AspI, the AspI site was end filled, and the fragment cloned into the BglII and end-filled AspI site of MUC1F(
TR) to generate MUC1F/4TR.
The MUC5AC chimera (MUC1F/5ACTR) includes a 402-bp PCR product of the MUC5AC cDNA clone Jer47 (GenBank Z34277:402552 and 744996). The MUC5AC PCR product, which includes flanking BstEII restriction sites, was blunt endcloned into the EcoRV restriction site of the pBluescript(SK) vector. The BstEII fragment was subsequently cloned into a pBluescript (SK) vector containing a modified multiple cloning site consisting of an adaptor duplex complementary to BamHI and HindIII restriction sites (5' GGATCCCAGATCTTGGTCACCGACATGGTCAAGCTT 3'). This cDNA was excised with BglII and AspI and cloned into MUC1F(
TR) to generate MUC1F/5ACTR.
The MUC5B chimera (MUC1F/5BTR) includes a 510-bp BamHIBstEII fragment of the MUC5B cDNA clone S1239 (GenBank Z72496:17912300). This fragment was cloned into a pBluescript (SK) vector containing a modified multiple cloning site consisting of an adaptor duplex complementary to KpnI and SacI restriction sites (5' CAGATCTATGGATCCGGTGACCGACATGGTCGGTAC 3'). This cDNA was excised with BglII and AspI and cloned into MUC1F(
TR) to generate MUC1F/5BTR. The Jer47 (Guyonnet Duperat et al., 1995
) and S1239 (Desseyn et al., 1997
) cDNA clones were kindly donated by Drs. Porchet, Laine, and Aubert.
Constructs were subcloned into the expression vector pHß-APr1neo (Gunning et al., 1987
) at either the BamHI or SalI site and confirmed by sequence analysis.
Expression of epitope-tagged mucins and generation of clonal lines
The Caco2 colon adenocarcinoma cell line (Fogh et al., 1977
), was cultured in Dulbeccos modified Eagle medium (Gibco BRL) supplemented with 10% fetal bovine serum.
A control transfected cell line (pHß-APr1-neo) and clones expressing MUC1F in Caco2 and HT29 were described previously (Reid et al., 1999
). The chimeric constructs and MUC1F(
TR) were transfected into Caco2 cells by standard techniques (Graham and van der Eb, 1973
) and clones carrying integrated constructs were selected using G418 (Gibco BRL) at 600 µg/ml. Multiple clones were isolated for each construct and evaluated for expression of the chimeric mucins.
Preparation of cell lysates
Cell lysates were prepared from confluent flasks of cells with 10 µl/cm2 of lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 5 mM EDTA, 1 mM PMSF, 1% [w/v] Triton X-100, 0.02% [w/v] NaN3). Lysates were cleared by centrifugation at 400 x g for 5 min and then at 15,000 x g for 5 min. Protein concentration of the cell lysates was assayed using the DC Protein Assay Kit (BioRad) with bovine serum albumin (BSA) standards. The samples were used immediately for immunopurification.
Immunopurification
Epitope-tagged mucins were immunoprecipitated with M2 antibody conjugated to agarose beads (Sigma) at 4°C for 15 h. The conjugated agarose beads were pelleted by centrifugation at 200 x g for 5 min, and rinsed twice with NET buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 5 mM EDTA) containing 1% (w/v) Triton X-100. For MS studies the rinsed pellets were subsequently washed in NET buffer without Triton X-100. For Western blot analysis immunoprecipitated mucin was eluted from the conjugated agarose beads with 500 µg/ml of FLAG peptide (Sigma) in NET buffer containing 1% (w/v) Triton X-100. The sample was heated to 80°C in sample loading buffer (2% [w/v] SDS, 62.5 mM Tris pH 6.8, 5% [w/v] glycerol, 5% [v/v] 2-mercaptoethanol, 0.01% [w/v] bromophenol blue) for 5 min before loading on SDSpolyacrylamide gels. For MS, immunoprecipitated mucin was eluted as above but without Triton X-100 and the supernatant collected and freeze-dried.
Media conditioned by postconfluent cells were collected and centrifuged at 200 x g to remove cell debris. Additional debris was removed by passing medium through a 0.22-µm filter. Epitope-tagged mucins were immunoprecipitated from the clarified medium at 4°C for 24 h. The conjugated agarose beads were processed as for western blot analysis.
Western blotting
Immunoprecipitated mucins were resolved using SDSPAGE (3% stacking gel and 6% resolving gel or 3% stacking gel and 10% resolving gel) (Laemmli, 1970
). Proteins were electrophoretically transferred to Hybond-C Super membranes (Amersham Pharmacia Biotech Ltd., UK), and blocked in 5% (w/v) fat-free dried skimmed milk (Marvel) in phosphate-buffered saline (PBS) (140 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO3, 1.4 mM KH2PO3, pH 7.3) for 1 h. Monoclonal antibodies were obtained from the following sources: M2 was purchased from Sigma; CO514, B67.4, CO431, B93.1, CSLEX1, B32.4, and B230.1 were gifts from Mark Reddish of Biomira Corp. (Edmonton, Alberta); GSLA2 was provided by John Magnani (Glycotech, Rockville, MD); and B72.3 and CC49 were gifts from David Colcher (University of Nebraska Medical Center, Omaha, NE). Polyclonal rabbit antisera CT-1 was the gift of Sandra Gendler (Mayo Clinic, Scottsdale, AZ), and HRP-conjugated goat anti-rabbit and rabbit anti-mouse antibodies were purchased from DAKO Ltd. (High Wycombe, UK). Primary antibodies were diluted 1:5001:2500 in PBS containing 1% (w/v) fat-free dried skim milk. Immunodetection was carried out as described previously (Pemberton et al., 1992
; Reid et al., 1999
). Enhanced chemiluminescence reagents (ECL) and ECL-sensitive film (Amersham Pharmacia Biotech Ltd., UK) were used for the final detection of antibodies.
Lectin analysis was performed using the DIG Glycan Differentiation Kit (Boehringer Mannheim), which included positive control proteins for all the lectins.
Positive controls for antibody reactivity were comprised of MUC1F in Caco2 or MUC1F in HT29 clones, where appropriate (Reid et al., 1999
). To control for nonspecific interactions of M2-agarose beads with other glycoproteins in the cell extracts, immunoprecipitated material from N30, a pHß-APr1-neo vector control transfected Caco2 cell line (Reid et al., 1999
), was evaluated for antibody reactivity.
Mass spectometry
Preparation of oligosaccharides.
O-linked oligosaccharides were liberated from the immunoprecipitated mucins by reductive elimination (400 µl of 1 M NaBH4 in 0.05 M NaOH at 45°C for 16 h) and desalted through a Dowex 50W-X8(H) column. Removal of traces of detergent was achieved by passing the desalted eluate through a Sep-Pak C18 column (Waters Corp.). Excess borates were removed by coevaporation with 10% (v/v) acetic acid in methanol under a stream of nitrogen.
Periodate oxidation.
Periodate oxidation was achieved by addition of 100 µl of 50 mM sodium m-periodate in 100 mM ammonium acetate buffer (pH 6.5) to the oligosaccharide mixture followed by standing at 0°C for 48 h in the dark. The reaction was quenched with 2 µl of ethylene glycol and left at room temperature for 1 h. Following lyophilization, the sample was reduced with 400 µl of 10 mg/ml NaBH4 in 2 M NH4OH for 2 h, after which the reaction was terminated with a few drops of glacial acetic acid and desalted and the excess borates were removed as described above.
Chemical derivatization for FAB-MS and GC-MS analysis.
Permethylation using a sodium hydroxide procedure was performed as described previously (Dell et al., 1994
). After derivatization the reactions were purified on Sep-Pak C18 (Dell et al., 1994
). Partially methylated alditol acetates were prepared from permethylated samples for GC-MS linkage analysis as described previously (Albersheim et al., 1967
).
FAB-MS analysis.
FAB-MS spectra were acquired using a ZAB-2S.E.2FPD mass spectrometer fitted with a cesium ion gun operated at 30 kV. Data acquisition and processing were performed using the VG Analytical Opus software. Solvents and matrices were as described previously (Dell et al., 1994
).
GC-MS analysis.
GC-MS analysis was carried out on a Fisons Instruments MD800 machine fitted with a DB-5 fused silica capillary column (30 m x 0.32 mm internal diameter, J&W Scientific). The partially methylated alditol acetates were dissolved in hexanes prior to column injection at 65°C. The GC oven was held at 65°C for 1 min before increasing to 290°C at a rate of 8°C/min.
Flow cytometry analyses
Cell lines were grown to about 80% confluence and released from tissue culture flasks by incubation for 30 min with PBS containing 0.5 mM EDTA and 0.1% (w/v) BSA. Approximately 5 x 105 cells were washed and incubated with M2 antibody in staining media (Dulbeccos modified Eagle medium containing 0.1% [w/v] BSA and 0.1% [w/v] NaN3) at 4°C for 1 h. Cells were then rinsed twice with staining media and incubated with the secondary antibody, fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG (Sigma) at 4°C for 1 h. After two rinses with staining media the cells were fixed for 10 min in 2% (v/v) formaldehyde. Ten thousand cells, resuspended in PBS containing 0.1% (w/v) BSA and 0.1% (w/v) NaN3, were analyzed on a Becton Dickinson FACStarPLUS.
| Acknowledgments |
|---|
|
|
|---|
We are grateful to Drs. Jim Gum (SMUC41), Nicole Porchet, Anne Laine, and Jean-Pierre Aubert (JER47 and S1239) for cDNA clones. We also thank Dr. Charles Kuszynski of the Cell Analysis Facility, University of Nebraska Medical Center, for assistance with flow cytometry analysis and Deborah Harrison for technical assistance. This work was supported by the Cystic Fibrosis Trust (UK); the National Institutes of Health (R01 CA78590, R01 CA57362, P30 CA 36727); the Nebraska Research Initiative; the Biotechnology and Biological Sciences Research Council; and the Wellcome Trust (Grants 030825, 046294 and a Biomedical Research Collaboration Grant [AH and MAH]). HSS is supported by the Keasbey Memorial Foundation; M.S-S is a recipient of a Medical Research Council studentship.
| Abbreviations |
|---|
|
|
|---|
aa, amino acid; BSA, bovine serum albumin; CSLEX1, sialyl Lex; ECL, enhanced chemiluminescence reagents; EI, electron impact; FAB, fast atom bombardment; FITC, fluorescein isothiocyanate; GC, gas chromatography; MAA, Maackia amurensis agglutinin; MS, mass spectrometry; PAGE, polyacrylamide gel electrophoresis; PBS, phosphate buffered saline; PCR, polymerase chain reaction; SNA, Sambucus nigra agglutinin; T antigen, Thomsen-Friedenreich antigen; Tn, GalNac-O-ser/thr; TR, tandem repeat; Tri-Tn, trimeric Tn.
| Footnotes |
|---|
1 To whom correspondence should be addressed
| References |
|---|
|
|
|---|
Albersheim, P., Nevins, D.J., English, P.D., and Karr, A. (1967) A method for the analysis of sugars in plant cell wall polysaccharides by gas-liquid chromatography. Carbohydr. Res., 5, 340345.
Baeckstrom, D., Hansson, G.C., Nilsson, O., Johansson, C., Gendler, S.J., and Lindholm, L. (1991) Purification and characterization of a membrane-bound and a secreted mucin-type glycoprotein carrying the carcinoma-associated sialyl-Lea epitope on distinct core proteins. J. Biol. Chem., 266, 2153721547.
Beum, P.V., Singh, J., Burdick, M., Hollingsworth, M.A., and Cheng, P.W. (1999) Expression of core 2 beta-1, 6-N-acetylglucosaminyltransferase in a human pancreatic cancer cell line results in altered expression of MUC1 tumor-associated epitopes. J. Biol. Chem., 274, 2464124648.
Boat, T.F., Welsh, M.J., and Beaudet, A.L. (1989) Cystic fibrosis. In Scriver, C.R., Beaudet, A.L., Sly, W.S. and Valle, D., eds. The Metabolic Basis of Inherited Disease. McGraw Hill, New York, pp. 26492680.
Boshell, M., Lalani, E.N., Pemberton, L., Burchell, J., Gendler, S., and Taylor-Papadimitriou, J. (1992) The product of the human MUC1 gene when secreted by mouse cells transfected with the full-length cDNA lacks the cytoplasmic tail. Biochem. Biophys. Res. Commun., 185, 18.[Web of Science][Medline]
Brockhausen, I., Yang, J.M., Burchell, J., Whitehouse, C., and Taylor-Papadimitriou, J. (1995) Mechanisms underlying aberrant glycosylation of MUC1 mucin in breast cancer cells. Eur. J. Biochem., 233, 607617.[Web of Science][Medline]
Burdick, M.D., Harris, A., Reid, C.J., Iwamura, T., and Hollingsworth, M.A. (1997) Oligosaccharides expressed on MUC1 produced by pancreatic and colon tumor cell lines. J. Biol. Chem., 272, 2419824202.
Carnoy, C., Ramphal, R., Scharfman, A., Lo-Guidice, J.M., Houdret, N., Klein, A., Galabert, C., Lamblin, G., and Roussel, P. (1993) Altered carbohydrate composition of salivary mucins from patients with cystic fibrosis and the adhesion of Pseudomonas aeruginosa. Am. J. Respir. Cell Mol. Biol., 9, 323334.
Cheng, P.W., Boat, T.F., Cranfill, K., Yankaskas, J.R., and Boucher, R.C. (1989) Increased sulfation of glycoconjugates by cultured nasal epithelial cells from patients with cystic fibrosis. J. Clin. Invest., 84, 6872.
Corfield, A.P., Warren, B.F., Bartolo, D.C., Wagner, S.A., and Clamp, J.R. (1992) Mucin changes in ileoanal pouches monitored by metabolic labelling and histochemistry. Br. J. Surg., 79, 12091212.[Web of Science][Medline]
Dell, A., Reason, A.J., Khoo, K.H., Panico, M., McDowell, R.A., and Morris, H.R. (1994) Mass spectrometry of carbohydrate-containing biopolymers. Methods Enzymol., 230, 108132.[Web of Science][Medline]
Desseyn, J.L., Guyonnet-Duperat, V., Porchet, N., Aubert, J.P., and Laine, A. (1997) Human mucin gene MUC5B, the 10.7-kb large central exon encodes various alternate subdomains resulting in a super-repeat. Structural evidence for a 11p15.5 gene family. J. Biol. Chem., 272, 31683178.
Fogh, J., Wright, W.C., and Loveless, J.D. (1977) Absence of HeLa cell contamination in 169 cell lines derived from human tumors. J. Natl Cancer Inst., 58, 209214.
Graham, F.L. and van der Eb, A.J. (1973) Transformation of rat cells by DNA of human adenovirus 5. Virology, 54, 536539.[Web of Science][Medline]
Gum, J.R. Jr., Hicks, J.W., Toribara, N.W., Siddiki, B., and Kim, Y.S. (1994) Molecular cloning of human intestinal mucin (MUC2) cDNA. Identification of the amino terminus and overall sequence similarity to prepro-von Willebrand factor. J. Biol. Chem., 269, 24402446.
Gunning, P., Leavitt, J., Muscat, G., Ng, S.Y., and Kedes, L. (1987) A human beta-actin expression vector system directs high-level accumulation of antisense transcripts. Proc. Natl Acad. Sci. USA, 84, 48314835.
Guyonnet Duperat, V., Audie, J.P., Debailleul, V., Laine, A., Buisine, M.P., Galiegue-Zouitina, S., Pigny, P., Degand, P., Aubert, J.P., and Porchet, N. (1995) Characterization of the human mucin gene MUC5AC: a consensus cysteine- rich domain for 11p15 mucin genes? Biochem. J., 305, 211219.
Hanisch, F.G., Uhlenbruck, G., Egge, H., and Peter-Katalinic, J. (1989) A B72.3 second-generation-monoclonal antibody (CC49) defines the mucin- carried carbohydrate epitope Gal beta(13) [NeuAc alpha(26)]GalNAc. Biol. Chem. Hoppe Seyler, 370, 2126.[Web of Science][Medline]
Hansen, J.E., Lund, O., Engelbrecht, J., Bohr, H., and Nielsen, J.O. (1995) Prediction of O-glycosylation of mammalian proteins: specificity patterns of UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase. Biochem. J., 308, 801813.
Hansen, J.E., Lund, O., Nilsson, J., Rapacki, K., and Brunak, S. (1998a) O-GLYCBASE Version 3.0: a revised database of O-glycosylated proteins. Nucleic Acids Res., 26, 387389.
Hansen, J.E., Lund, O., Tolstrup, N., Gooley, A.A., Williams, K.L., and Brunak, S. (1998b) NetOglyc: prediction of mucin type O-glycosylation sites based on sequence context and surface accessibility. Glycoconj. J., 15, 115130.[Web of Science][Medline]
Hennebicq, S., Tetaert, D., Soudan, B., Briand, G., Richet, C., Demeyer, D., Gagnon, J., Petillot, Y., and Degand, P. (1998) Polypeptide:N-acetylgalactosaminyltransferase activities towards the mucin MUC5AC peptide motif using microsomal preparations of normal and tumoral digestive mucosa. Biochimie, 80, 6973.[Medline]
Ikehara, Y., Kojima, N., Kurosawa, N., Kudo, T., Kono, M., Nishihara, S., Issiki, S., Morozumi, K., Itzkowitz, S., Tsuda, T., and others (1999) Cloning and expression of a human gene encoding an N- acetylgalactosamine-alpha2, 6-sialyltransferase (ST6GalNAc I): a candidate for synthesis of cancer-associated sialyl-Tn antigens. Glycobiology, 9, 12131224.
Kurosawa, N., Hamamoto, T., Lee, Y.C., Nakaoka, T., Kojima, N., and Tsuji, S. (1994a) Molecular cloning and expression of GalNAc alpha 2, 6-sialyltransferase. J. Biol. Chem., 269, 14021409.
Kurosawa, N., Kojima, N., Inoue, M., Hamamoto, T., and Tsuji, S. (1994b) Cloning and expression of Gal beta 1, 3GalNAc-specific GalNAc alpha 2, 6- sialyltransferase. J. Biol. Chem., 269, 1904819053.
Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680685.[Medline]
Litvinov, S.V., and Hilkens, J. (1993) The epithelial sialomucin, episialin, is sialylated during recycling. J. Biol. Chem., 268, 2136421371.
Martensson, S., Levery, S.B., Fang, T.T., and Bendiak, B. (1998) Neutral core oligosaccharides of bovine submaxillary mucinuse of lead tetraacetate in the cold for establishing branch positions. Eur. J. Biochem., 258, 603622.[Web of Science][Medline]
Metzgar, R.S., Gaillard, M.T., Levine, S.J., Tuck, F.L., Bossen, E.H., and Borowitz, M.J. (1982) Antigens of human pancreatic adenocarcinoma cells defined by murine monoclonal antibodies. Cancer Res., 42, 601608.
Muller, S., Alving, K., Peter-Katalinic, J., Zachara, N., Gooley, A.A., and Hanisch, F.G. (1999) High density O-glycosylation on tandem repeat peptide from secretory MUC1 of T47D breast cancer cells. J. Biol. Chem., 274, 1816518172.
Muller, S., Goletz, S., Packer, N., Gooley, A., Lawson, A.M., and Hanisch, F.G. (1997) Localization of O-glycosylation sites on glycopeptide fragments from lactation-associated MUC1. All putative sites within the tandem repeat are glycosylation targets in vivo. J. Biol. Chem., 272, 2478024793.
Nehrke, K., Hagen, F.K., and Tabak, L.A. (1996) Charge distribution of flanking amino acids influences O-glycan acquisition in vivo. J. Biol. Chem., 271, 70617065.
OBoyle, K.P., Markowitz, A.L., Khorshidi, M., Lalezari, P., Longenecker, B.M., Lloyd, K.O., Welt, S., and Wright, K.E. (1996) Specificity analysis of murine monoclonal antibodies reactive with Tn, sialylated Tn, T, and monosialylated (2
6) T antigens. Hybridoma, 15, 401408.[Web of Science][Medline]
OConnell, B., Tabak, L.A., and Ramasubbu, N. (1991) The influence of flanking sequences on O-glycosylation. Biochem. Biophys. Res. Commun., 180, 10241030.[Web of Science][Medline]
Pemberton, L., Taylor-Papadimitriou, J., and Gendler, S.J. (1992) Antibodies to the cytoplasmic domain of the MUC1 mucin show conservation throughout mammals. Biochem. Biophys. Res. Commun., 185, 167175.[Web of Science][Medline]
Pisano, A., Packer, N.H., Redmond, J.W., Williams, K.L., and Gooley, A.A. (1994) Characterization of O-linked glycosylation motifs in the glycopeptide domain of bovine kappa-casein. Glycobiology, 4, 837844.
Pisano, A., Redmond, J.W., Williams, K.L., and Gooley, A.A. (1993) Glycosylation sites identified by solid-phase Edman degradation: O- linked glycosylation motifs on human glycophorin A. Glycobiology, 3, 429435.
Reid, C.J., Burdick, M.D., Hollingsworth, M.A., and Harris, A. (1999) CFTR expression does not influence glycosylation of an epitope-tagged MUC1 mucin in colon carcinoma cell lines. Glycobiology, 9, 389398.
Rhodes, J.M. (1997) Colonic mucus and ulcerative colitis [comment]. Gut, 40, 807808.
Rose, M.C. (1992) Mucins: structure, function, and role in pulmonary diseases [see comments]. Am. J. Physiol., 263, L413L429.
Soudan, B., Tetaert, D., Hennebicq, S., Briand, G., Zerimech, F., Richet, C., Demeyer, D., Gagnon, J., Petillot, Y., and Degand, P. (1998) Dipeptidyl aminotransferase activity and in vitro O-glycosylation of MUC5AC mucin motif peptides by human gastric microsomal preparations. J. Pept. Res., 51, 346354.[Web of Science][Medline]
Stoll, M.S., Hounsell, E.F., Lawson, A.M., Chai, W.G., and Ten, F.Z. (1990) Microscale sequencing of O-linked oligosaccharides using mild periodate oxidation of alditols, coupling to phospholipid and TLC-MS analysis of the resulting neoglycolipids [published erratum appears in Eur. J. Biochem. 1990 Sep 24;192(3):813]. Eur. J. Biochem., 189, 499507.[Web of Science][Medline]
Thomsson, K.A., Carlstedt, I., Karlsson, N.G., Karlsson, H., and Hansson, G.C. (1998) Different O-glycosylation of respiratory mucin glycopeptides from a patient with cystic fibrosis [In Process Citation]. Glycoconj. J., 15, 823833.[Web of Science][Medline]
Thornton, D.J., Sheehan, J.K., and Carlstedt, I. (1991a) Heterogeneity of mucus glycoproteins from cystic fibrotic sputum. Are there different families of mucins? Biochem. J., 276, 677682.
Thornton, D.J., Sheehan, J.K., Lindgren, H., and Carlstedt, I. (1991b) Mucus glycoproteins from cystic fibrotic sputum. Macromolecular properties and structural architecture. Biochem. J., 276, 667675.
van Halbeek, H., Strang, A.M., Lhermitte, M., Rahmoune, H., Lamblin, G., and Roussel, P. (1994) Structures of monosialyl oligosaccharides isolated from the respiratory mucins of a non-secretor (O, Lea+b-) patient suffering from chronic bronchitis. Characterization of a novel type of mucin carbohydrate core structure. Glycobiology, 4, 203219.
Wang, Y., Abernethy, J.L., Eckhardt, A.E., and Hill, R.L. (1992) Purification and characterization of a UDP-GalNAc:polypeptide N- acetylgalactosaminyltransferase specific for glycosylation of threonine residues. J. Biol. Chem., 267, 1270912716.
Wang, Y., Agrwal, N., Eckhardt, A.E., Stevens, R.D., and Hill, R.L. (1993) The acceptor substrate specificity of porcine submaxillary UDP- GalNAc:polypeptide N-acetylgalactosaminyltransferase is dependent on the amino acid sequences adjacent to serine and threonine residues. J. Biol. Chem., 268, 2297922983.
Zhang, Y., Doranz, B., Yankaskas, J.R., and Engelhardt, J.F. (1995) Genotypic analysis of respiratory mucous sulfation defects in cystic fibrosis. J. Clin. Invest., 96, 29973004.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
P. K. Singh, Y. Wen, B. J. Swanson, K. Shanmugam, A. Kazlauskas, R. L. Cerny, S. J. Gendler, and M. A. Hollingsworth Platelet-Derived Growth Factor Receptor {beta}-Mediated Phosphorylation of MUC1 Enhances Invasiveness in Pancreatic Adenocarcinoma Cells Cancer Res., June 1, 2007; 67(11): 5201 - 5210. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. Round, T. J. McMaster, M. J. Miles, A. P. Corfield, and M. Berry The isolated MUC5AC gene product from human ocular mucin displays intramolecular conformational heterogeneity Glycobiology, June 1, 2007; 17(6): 578 - 585. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Parry, F. G. Hanisch, S.-H. Leir, M. Sutton-Smith, H. R. Morris, A. Dell, and A. Harris N-Glycosylation of the MUC1 mucin in epithelial cells and secretions Glycobiology, July 1, 2006; 16(7): 623 - 634. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Xia, J. A. Royall, G. Damera, G. P. Sachdev, and R. D. Cummings Altered O-glycosylation and sulfation of airway mucins associated with cystic fibrosis Glycobiology, August 1, 2005; 15(8): 747 - 775. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-H. Leir, S. Parry, T. Palmai-Pallag, J. Evans, H. R. Morris, A. Dell, and A. Harris Mucin Glycosylation and Sulphation in Airway Epithelial Cells Is Not Influenced by Cystic Fibrosis Transmembrane Conductance Regulator Expression Am. J. Respir. Cell Mol. Biol., May 1, 2005; 32(5): 453 - 461. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Santos-Silva, A. Fonseca, T. Caffrey, F. Carvalho, P. Mesquita, C. Reis, R. Almeida, L. David, and M. A. Hollingsworth Thomsen-Friedenreich antigen expression in gastric carcinomas is associated with MUC1 mucin VNTR polymorphism Glycobiology, May 1, 2005; 15(5): 511 - 517. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Cullen, W. Sabbagh Jr., E. Graham, M. M. Irick, E. K. van Olden, C. Neal, J. Delrow, L. Bardwell, and G. F. Sprague Jr. A signaling mucin at the head of the Cdc42- and MAPK-dependent filamentous growth pathway in yeast Genes & Dev., July 15, 2004; 18(14): 1695 - 1708. [Abstract] [Full Text] [PDF] |
||||
![]() |
M Berry, R B Ellingham, and A P Corfield Human preocular mucins reflect changes in surface physiology Br. J. Ophthalmol., March 1, 2004; 88(3): 377 - 383. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wen, T. C. Caffrey, M. J. Wheelock, K. R. Johnson, and M. A. Hollingsworth Nuclear Association of the Cytoplasmic Tail of MUC1 and {beta}-Catenin J. Biol. Chem., September 26, 2003; 278(39): 38029 - 38039. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. S. Silverman, M. Sutton-Smith, K. McDermott, P. Heal, S.-H. Leir, H. R. Morris, M. A. Hollingsworth, A. Dell, and A. Harris The contribution of tandem repeat number to the O-glycosylation of mucins Glycobiology, April 1, 2003; 13(4): 265 - 277. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Lofling, E. Hauzenberger, and J. Holgersson Absorption of anti-blood group A antibodies on P-selectin glycoprotein ligand-1/immunoglobulin chimeras carrying blood group A determinants: core saccharide chain specificity of the Se and H gene encoded {alpha}1,2 fucosyltransferases in different host cells Glycobiology, March 1, 2002; 12(3): 173 - 182. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||












