Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (19)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Polzer, S.
Right arrow Articles by Schreiber, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Polzer, S.
Right arrow Articles by Schreiber, M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Glycobiology, 2001, Vol. 11, No. 1 11-19
© 2001 Oxford University Press

Loss of N-linked glycans in the V3-loop region of gp120 is correlated to an enhanced infectivity of HIV-1

Svenja Polzer, Matthias T. Dittmar2, Herbert Schmitz, Bernd Meyer3, Harm Müller, Hans-Georg Kräusslich2 and Michael Schreiber1

Bernhard Nocht Institute for Tropical Medicine, Bernhard Nocht Strasse 75, 20359 Hamburg, Germany, 2Heinrich Pette Institute, Martinistrasse 52, 20251 Hamburg, Germany, and 3Institute for Organic Chemistry University of Hamburg, Martin-Luther-King-Pl. 6, 20146 Hamburg, Germany

Received on April 4, 2000; revised on July 27, 2000; accepted on August 2, 2000.


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
We describe mutants of human immunodeficiency virus type-1 (HIV-1) strain NL4-3, which are lacking the thirteenth, fifteenth, or seventeenth sites for N-linked glycosylation (g13, g15, g17) of the envelope protein gp120. All three sites are located within the hypervariable V3 loop region of gp120. Those mutants lacking carbohydrates g15 or combinations of g15/g17 showed markedly higher infectivity for GHOST cells (human osteosarcoma cells) expressing CXCR4 (GHOST-X4), compared to the fully glycosylated NL4-3 wild type virus. In addition, these mutants could also infect cells which exhibits low background expression of CXCR4, corresponding to <10% of that observed for GHOST-X4 cells. In addition to the enhanced infectivity observed, mutants lacking g15 and g17 showed increased resistance to inhibition by SDF-1, the natural ligand of CXCR4. Thus, loss of the oligosaccharides g15 and g17 in the V3 region of gp120 markedly influences CXCR4-specific infection.

Key words: HIV-1/infectivity/V3 loop/glycosylation/coreceptor


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
The entry of HIV-1 into cells requires the binding of the outer envelope glycoprotein (gp120) to CD4 receptor (Dalgleish et al., 1984) and chemokine receptors (seven-trans-membrane receptors) (Alkhatib et al., 1996Go; Choe et al., 1996Go; Doranz et al., 1996Go; Dragic et al., 1996Go; Feng et al., 1996Go). The two chemokine receptors CCR5 and CXCR4 are the coreceptors mainly used by HIV-1 strains and patient isolates (Deng et al., 1996Go; Zhang et al., 1998Go). The V3 loop of gp120 plays major role for the interaction with coreceptor CCR5 or CXCR4 (Berger et al., 1998Go; Cocchi et al., 1996Go). The V3 loop is also the target of neutralizing antibodies (Rusche et al., 1988Go) but neutralization is limited by the fact that the V3 loop and the flanking regions are highly variable, differing in the amino acid sequence, the length of the loop (Milich et al., 1993Go), and the pattern of NXS and NXT glycosylation sites present (Fenouillet et al., 1990Go; Schonning et al., 1996aGo; Cheng-Mayer et al., 1999Go). Since HIV-1 variants are selected under the pressure of the immune system, the V3 loop, as the antibody binding domain (Rusche et al., 1988Go) also involved in coreceptor interaction (Cocchi et al., 1996Go; Hoffman et al., 1999Go), is the gp120 domain that drives HIV-1 variability and escape from immune surveillance.

The gp120 glycoprotein is extensively glycosylated, and more than 50% of the molecular mass are carbohydrates (Leonard et al., 1990Go). Recently, it was shown in the SIV monkey model that SIVmac239 mutants lacking N-linked glycosylation within the V1 loop are more immunogenic compared to the SIVmac239 wild type (Reitter et al., 1998Go). Highly reactive humoral immune responses were obtained after infection of monkeys with SIV strains containing such partially nonglycosylated external glycoproteins. In the same infected monkeys viremia of non-glycosylated mutants was low, but during the course of infection viruses resistant to neutralization by antibodies emerged. The resistant viruses were becoming predominant because a mutation had reintroduced the glycosylation site for N-linked carbohydrates in the SIV V1 loop. Thus, in the SIV model, the V1 loop carbohydrates are triggering the escape from V1-specific neutralizing antibodies. These data demonstrate that carbohydrates are responsible for masking immunodominant epitopes on the external glycoprotein and in this way carbohydrates can protect viruses against neutralizing antibodies.

Carbohydrates are also playing a role in the immune response against HIV-1 by masking the immunodominant V3 loop epitope (Schonning et al., 1996aGo). Resistance to or escape from V3 loop neutralizing monoclonal antibodies is usually seen by changes of the amino acid sequence in the antibody binding site, but it was also shown that HIV-1 escape from neutralization is caused by acquisition of carbohydrates (Schonning et al., 1996bGo). Since the HIV-1 V3 loop is the major target for neutralizing antibodies (Rusche et al., 1988Go), its masking by carbohydrates may influence the antigenicity and immunogenicity of total gp120.

Besides the role of glycosylation as a barrier for antibodies (Back et al., 1994Go; Cheng-Mayer et al., 1999Go; Reitter et al., 1998Go; Schonning et al., 1996aGo,b), the V3 loop is the gp120 determinant that facilitates binding to the coreceptor molecules on CD4+ cells (Cocchi et al., 1996Go; Kwong et al., 2000Go). Recent data show that V3 peptides representing sequences of T-tropic strains directly bind to CXCR4 (Sakaida et al., 1998Go). In addition to these experiments it was shown that enzymatically treated, nonglycosylated forms of HIV-1 (SF-2) gp120 bound much more readily to CXCR4 compared to the SF-2 gp120 containing intact carbohydrate structures (Bandres et al., 1998Go). Thus, the totally nonglycosylated gp120 might present a more open coreceptor binding domain allowing a much better binding to coreceptors, an important step in HIV infection.

HIV strains are functionally classified with respect to their ability to use one or various coreceptor molecules for cell entry. Monotropic viruses, using only one coreceptor like CCR5 or CXCR4, are called R5 or X4 strains whereas dualtropic viruses, using either CCR5 or CXCR4, are called R5X4. In HIV transmission R5 strains are predominant and persist throughout infection (Rodrigo, 1997Go). In the late stage of HIV infection R5X4 and X4 strains have been shown to emerge (Kuiken et al., 1992Go; Goudsmit, 1995Go). Of clinical importance is the observation that the emergence of CXCR4-specific viruses correlates with the decline of CD4+ T-cell numbers and the progression to AIDS (Connor et al., 1997Go; Spijkerman et al., 1998Go). Mutations in the gp120 V3 loop can lead to a switch from the R5 to the X4 phenotype, which is a more pathogenic type of virus (Saag et al., 1994Go; Goudsmit, 1995Go).

To study the role of the V3 loop carbohydrates in CXCR4 specific infection, we have constructed a set of HIV-1 (NL4-3) molecular clones, all differing in the number of N-linked glycosylation sites within and around the V3 loop region. These V3 loop glycosylation mutants were tested for CXCR4-specific infection compared to the NL4-3 wild type. The overall conclusion of the present study is that NL4-3 viruses lacking two of the five V3 loop carbohydrate structures show enhanced infectivity and enhanced resistance to SDF-1, probably because the coreceptor binding region of these viruses is more exposed and more accessible to CXCR4 compared to viruses containing carbohydrate shielded V3 loop regions.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
Generation of NL4-3 mutants lacking V3 loop N-glycosylation sites
The NL4-3 V3 region contains five highly conserved N-glycosylation sites (NXS or NXT). In order to analyze the influence of V3 loop carbohydrates on HIV infection we have constructed mutants affecting glycosylation sites g13, g15, or g17 in the V3 region of gp120, either alone or in combination (Figure 1a). These positions were selected, because V3 sequence comparisons available from the Los Alamos Database showed lack of g13, g15, and g17 in some HIV-1 strains whereas g14 and g16 was present in most of the sequences analyzed. Changes were made by altering Asn codons in g13, and g17 to Gln codons (NTS>QTS, NAT>QAT) and by exchanging the g15 sequence Asn-Asn-Asn into Gly-Ser-Thr, a mutated g15 site which has been found in primary patient isolates (Schreiber et al., 1994Go). Two additional mutants only lacking g15 were generated by altering NNT into NNI or NNK. By exchanging the V3 region of the NL4-3 env gene (Figure 1b), nine molecular clones were generated containing combinations of the three mutated glycosylation sites. DNA of pNL4-3 mutants was transfected into Hela-P4 cells, and corresponding viruses were propagated in IL-2 and PHA stimulated PBMC infected with the Hela cell culture supernatants.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 1. Cloning strategy. (A) V3 loop amino acid sequence of NL4-3 including the five N-glycosylation sites g13 to g17 (underlined). The three sites g13, g15, and g17 were changed from NTS to QTS, from NNNT to GSTT, and from NAT to QAT (black arrows), respectively. Mutants lacking N-glycosylation sites in single or combination were generated by the exchange of the NL4-3 V3 region using synthetic oligonucleotides (B). Oligonucleotides were hybridized and amplified by PCR. After cleavage with BglII and NheI the V3 fragment was inserted into the V3 deleted env gene of pUCenv-{Delta}V3. From the pUC vector the BstEII–BamHI env fragment was cloned into pNL4-3-Bst. This procedure was carried out to generate clones of NL4-3 lacking single, dual or triple combinations of V3 loop glycosylation sites.

 
Coreceptor usage of NL4-3 mutants differing in V3 loop glycosylation
To analyze the coreceptor usage of NL4-3 mutants we infected GHOST cells expressing CD4 alone or in combination with various coreceptors. Infection of GHOST cells is shown either as foci forming units (ffu) per ng of p24 or per ml of culture supernatant (Table I). HIV-1 strain NL4-3 which has used for construction of mutant proviral clones is CXCR4-tropic, and we observed infection of GHOST CXCR4 cells in all cases. Using CCR1, CCR2b, CCR3 CCR4, CCR5, BOB, or Bonzo expressing GHOST cells no infection was found (data not shown). Infection of GHOST CXCR4 cells with wild type or variant viruses using 10 ng p24 per ml revealed significantly higher infectious titers for glycosylation mutants g15/17 and g13/15/17, both lacking glycosylation sites g15 and g17, when compared to wild type HIV-1 (Table I, left column [ffu/ng p24]). Infectivity was enhanced 11-fold in case of the env-g15/17 variant and 7-fold in case of the env-g13/15/17 variant, while all other variants showed titers comparable to wild type HIV-1. Interestingly, the three variants lacking glycosylation site g15 could also infect the parental GHOST cells, which express CXCR4 at a low background, albeit at a much lower relative infectivity (Table I). No infection of parental GHOST cells was observed for the other variants.


View this table:
[in this window]
[in a new window]
 
Table I. Infection of GHOST indicator cell lines with NL4-3 mutants differing in the glycosylation pattern of the V3 loop
 
To further analyze this phenotype, we infected GHOST and GHOST CXCR4 cells using a higher infectious dose >103 ffu/ml (Table I, right column). Again, infection of the parental GHOST cell line was observed for the partially non-glycosylated viruses env-g15, env-g13/15, NL4-3env-g15/17, and env-g13/15/17. No infection of GHOST cells was detected for wild type HIV-1 or those mutants retaining the g15 site (Table I). Variants lacking g17 in addition to g15 exhibited a higher titer on GHOST cells, consistent with the higher infectivity of these mutants on GHOST CXCR4 cells determined in the previous experiment. To determine whether the infectivity of glycosylation mutants on the parental GHOST cells is due to background expression of CXCR4 on these cells, we performed FACS analysis of GHOST and GHOST CXCR4 cells. As shown in Figure 2, GHOST cells exhibited low expression of CXCR4, corresponding to <10% of that observed for GHOST CXCR4 cells.



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 2. Surface expression of human CXCR4 on GHOST parental and GHOST-CXCR4 indicator cell lines monitored by flow cytometry. The histograms show analysis with anti-CXCR4 (black) and isotype-matched control antibodies (gray). Cell count is plotted against fluorescence intensity.

 
SDF-1 inhibition of NL4-3 mutants differing in V3 loop glycosylation
SDF-1 is the natural ligand of CXCR4 and addition of SDF-1 blocks HIV-1 infection via the CXCR4 coreceptor. We therefore determined the relative SDF-1 sensitivity of wild type and NL4-3 mutants (Figure 3). Mutants lacking single glycosylation sites g13 and g17 all showed SDF-1 sensitivities in the same range as the wt virus. Only mutants lacking g15 showed a tendency to a more resistant phenotype but the effect observed was rather weak (Figure 3a). Thus, the lack of only a single glycan in the gp120 V3 region had no significant effect on SDF-1 inhibition. Interestingly, mutants lacking two glycosylation sites g15 and g17 (env-g15/17, env-g13/15/17), which had been shown to infect parental GHOST cells efficiently (Table I), were more resistant to SDF-1 inhibition than their counterparts.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 3. Effects of SDF-1 on infection of GHOST-CXCR4 cells with NL4-3 mutants differing in V3 loop glycosylation. Solid symbols, mutants generally lacking glycosylation site g15. Open symbols, mutants containing g15.

 
Taken together, wild type virus and mutants containing g15 all exhibited a similar sensitivity towards SDF-1, showing complete inhibition at a concentration of 500 ng/ml. Mutants lacking g15 showed little effects on SDF-1 inhibition, whereas the lack of g15 and g17 leads to significant resistance against SDF-1.

Our data demonstrate that infectivity of NL4-3 mutants for cells expressing high or low surface levels of CXCR4 or in the presence of SDF-1 appears to depend highly on the presence of g15 and g17, indicating that glycosylation of these sites affects the binding affinity for the viral receptors.

Modeling of the glycosylated V3 loop
A three-dimensional model of the V3 loop and the five carbohydrates structures was developed based on NMR structures of unglycosylated and glycosylated V3 loops as well as the information from the x-ray structure (Wyatt et al., 1998Go). Contrary to literature data that postulates that sequences NCT (g14) or NCS (g16) are not normally glycosylated the x-ray structure analysis of the truncated gp120/CD4/mAB complex showed unequivocally that this sequence as well as the CNIS sequence at the C-terminal end of the V3-loop carry carbohydrate chains. Using this information we performed a homology replacement of the amino acids of a synthetic glycosylated V3 loop to arrive at the sequence of NL4-3. The 3D structure of the glycosylated V3 loop was determined by NMR spectroscopy (Meyer et al., unpublished observations). The mutated V3-sequence was optimized by a MD simulation in a water box. The biantennary decasaccharide was chosen as a minimal structure to represent complex type sugars at g15. The oligomannosidic structures at positions g13, g14, g16, and g17 were represented by a Man8 structure. The 3D structure of these oligosaccharides was optimized and the local minima obtained were used to connect the oligosaccharides to the peptide backbone. Subsequently, a MD simulation of the resultant glycoprotein in a water box for 600 ps yielded the structure depicted in Figure 4a,b. Here, the carbohydrate chains largely shield the peptide from direct interaction with receptors on human cells.




View larger version (122K):
[in this window]
[in a new window]
 
Fig. 4. Three-dimensional models of the V3 loop. The V3 loop (red) shielded by five N-glycans g13 (blue), g14 (gray), g15 (yellow), g16 (gray), g17 (green). The tip of the loop (orange) becomes exposed after removal of g13, g15 and g17. (A) Front view. (B) Rear view.

 
Also, interaction of carbohydrate residues with amino acids leads to the stabilization of the carbohydrate–peptide structure although the carbohydrate residues of N-linked glycans are both flexible and highly hydrated. Our model of the V3 loop shows that the loop (shown in red) and the conserved tip of the loop, the GPGRAF sequence (shown in orange), is surrounded by carbohydrates. The carbohydrates are masking the V3 structure in such a way that the tip of the loop is surrounded by sugar residues. Lack of both carbohydrates g15 (yellow) and g17 (green) lead to an unmasking, the exposure of the V3 loop structure. The two carbohydrates g15 and g17 are covering most parts of the tip of the V3 loop whereas g13 seems to be not involved in shielding V3 epitopes.


    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
In this study, we have used the CXCR4-specific laboratory strain NL4-3, one of the best studied HIV-1 strains, as a model to analyze the role of V3-based carbohydrates on the interaction between gp120 and the CXCR4 coreceptor. Mutants of NL4-3 differing in glycosylation of sites g13, g15, and g17 in and around the V3 loop were tested for infection of GHOST CXCR4 and parental GHOST cell lines. Lack of glycosylation sites g15 or g15 and g17 led to increased infectivity of GHOST CXCR4 cells and even permitted infection of parental GHOST cells, which are resistant to wild type, fully glycosylated, HIV-1. In agreement with the results of Lee et al. (1999)Go, we showed that GHOST cells express low levels of CXCR4. In our study this low CXCR4 expressing appears to be sufficient for infection only when the V3 loop is not masked by carbohydrates. Mutants lacking specific V3 loop glycosylation sites have probably an increased affinity of the viral surface glycoprotein for the CXCR4 coreceptor, which is also supported by the enhanced resistance against SDF-1 inhibition. Thus, carbohydrates play a significant role in CXCR4-specific infection.

Generating mutants differing in V3 glycosylation is based on amino acid exchanges altering the recognition site for N-linked glycosylation. In our study we have changed codons for g13 and g17 in such a way that the Asn codon was replaced by Gln, the chemically most similar amino acid. Changing the codon for g15 is more critical because changes in the sequence of the V3 loop can also directly influence the viral phenotype, which is mostly found if positively charged amino acids are introduced (De Jong et al., 1992Go). Alteration of the NNT recognition site for g15 by an exchange of Asn against Gln introduces an amino acid normally not present in V3 sequences (Korber et al., 1998Go). Therefore, NNNT was exchanged for GSTT, NNNK, and NNNI, respectively, to produce sequences at this site that are also naturally occurring (Schreiber et al., 1994Go).

In addition to amino acid variations of the gp120 V3 loop the oligosaccharide part is also highly diverse (Feizi and Larkin, 1990Go; Liedtke et al., 1997Go). Both complex type and high mannose type structures are found depending on the expression system and the genetic sequence. To produce virus mutants containing the identical glycosylation pattern as present in vivo we therefore have used human PBMC instead of laboratory cell lines. Virus produced in PBMC cell cultures has the identical pattern of gp120 glycosylation as it is present in the in vivo situation. However, it has been established that the glycosylation pattern at an individual glycosylation site can also vary dependent on the presence or absence of other sites (Pfeiffer et al., 1994Go). Thus, it is conceivable that complex type chains are replaced by high mannose carbohydrates at other sites outside the V3 loop or vice versa. Changing a complex type sugar to high mannose type can, for example, lead to the binding of MBP (mannose binding protein) that might influence viral infectivity (Ezekowitz et al., 1989Go; Larkin et al., 1989Go). However, each carbohydrate structure is a substantial space-occupying part of gp120 that is displayed on the outer surface of the virions able to interact with other molecules. A fundamental role of V3 based carbohydrates, especially at g15, is to shield the V3 loop from antibody binding. On the other hand, the V3 loop is interacting with the coreceptors CCR5 or CXCR4. Thus, prevention of antibody binding by carbohydrate shielding might also prevent the effective binding to the chemokine receptor molecules. The role of carbohydrates in shielding the V3 loop might become more complex since the coreceptors CCR5 and CXCR4 are differing in their carbohydrate content and future work is needed to study the role of V3 based carbohydrates for coreceptor switching.

A study defining the role of V3 loop carbohydrates was carried out by Nakayama et al. (1998)Go. They also studied the role of V3 loop sugars using a mutant of NL4-3 lacking glycosylation at g15 (NNT to NNI). They reported that NL4-3 V3 glycosylation at g15 has a negative effect on infection of CXCR4 positive cells. In our experiments we have also shown that NNI has a negative effect that reduces viral replication by 30%. Another mutant lacking g15, the NNK mutant, containing a positively charged Lys instead of the Thr again showed a replication reduced by 30%. Both experiments demonstrate that lack of g15 alone had no dramatic effect on replication rate of the NL4-3 virus. Also, introduction of the positively charged amino acid had no enhancing effect on viral replication or infectivity. The GSTT mutant only lacking g15 showed a 3-fold increase in infectivity and furthermore this virus was able to infect the parental GHOST cells expressing low levels of CXCR4. This was only seen with the GSTT g15 mutant and not with the NNI nor NNK mutants. Therefore, it might be possible that the amino acid motif GSTT together with the lack of g15 is responsible for the enhanced infectivity observed. Losman et al. (1999)Go also studied the influence of carbohydrates at g15 on CXCR4-specific infection. Using a mutant of the HIV-1 strain BRU lacking g15, they showed that the lack of a single carbohydrate structure neither impairs nor improves infectivity. In our study, the same weak effects on viral replication were observed with viruses lacking g13 or g17. Thus, in all studies, only little or no effects on CXCR4-specific infection were observed using mutants lacking a single V3-based carbohydrate structure.

To further test the effect of carbohydrates on infectivity, we have tested all permutations of doubly and triply deglycosylated virus mutants (Figure 1). Our data demonstrate that mutants lacking g15 and g17 showed a dramatic increase in infectivity (Table I). The enhancement of infectivity was only seen with the g15/g17 double and g13/g15/g17 triple mutants of 7-fold and 12-fold, respectively. Interestingly, the lack of g15 in combination with g13 did not show any effect on infectivity. Therefore, our data indicate that carbohydrates at g15 and g17 are responsible for an efficient shielding of the V3 loop (Kwong et al., 2000Go). Double mutants lacking g15 and g17 showed enhanced infection, were able to use low CXCR4 levels, and were highly resistant against SDF-1. Fully glycosylated NL4-3 and all other glycosylation mutants did not show such CXCR4-specific properties. Because of these reasons we suggest that both carbohydrates at g15 and g17 are responsible for the masking of the CXCR4 binding region of gp120.

Using a three-dimensional model of the V3 loop the role of g15 and g17 for masking the V3 loop was visualized. Both carbohydrates are close to the tip of the V3 loop and are together covering the GPGRAF motif which is the conserved part of the V3 loop of B subtype viruses. This GPGRAF motif as well as the left side of the loop are the targets for broadly neutralizing antibodies. Since both carbohydrates are close to these regions it is suggestive that masking by g15 and g17 can prevent the binding of neutralizing antibodies against the V3 loop. On the other hand, masking by carbohydrates might reduce the affinity not only for neutralizing V3-antibodies it might also reduce the binding affinity for the CXCR4 coreceptor.

It has been reported that the carbohydrate at g15 is responsible for shielding SIV or HIV-1 against immune recognition and against binding to neutralizing antibodies (Reitter et al., 1998Go; Schonning et al., 1996aGo,b). In the SHIV model it was shown that escape of SHIV SF33 from neutralizing immune response was due to the reintroduction of the g15 glycosylation site (Cheng-Mayer et al., 1999Go). In agreement with our study and the observations of Nakayama et al. (1998)Go and Losman et al. (1999)Go, lack of a single SF33 glycosylation site at g15 showed no dramatic effect on viral replication. Taken together these data indicate that the coreceptor binding site of X4 viruses is only slightly affected by alterations at g15 alone. To make this domain more accessible to CXCR4 the lack of a second glycosylation site downstream of g15 seems to be relevant. From the 3D model of the gp120 trimer made by Moulard et al. (2000)Go and Kwong et al. (2000)Go it seems to be clear that the V3 loop is the most important part that influences binding to CXCR4. In addition to their data on the influence of amino acid exchanges on the binding specificities of the gp120 trimer our data demonstrate a role for g15 together with g17 in masking the coreceptor binding surface of the gp120 trimer.

It has been reported that carbohydrates of gp120 can mediate binding of viruses to the host cells by an interaction of high mannose glycans with mannose receptors (Ezekowitz et al., 1989Go; Larkin et al., 1989Go) or by a galactose specific interaction of the terminal residues of complex type chains (Manca, 1992Go). The change of complex type sugar to a high mannose or hybrid type structure would also change the nature of the mannose and galactose mediated interactions and might thus contribute to the infectivity. Besides studies on HIV, a role for carbohydrates in modulating virus–receptor interactions was demonstrated for influenza A. It has been shown that two carbohydrate moieties in the vicinity of the receptor binding site of the hemagglutinin (HA) are regulating the receptor binding affinity. Lack of the sugars attached to Asn 123 and Asn 149 results in strong binding of HA to neuraminic acid-containing receptors. Viruses lacking both sugars were unable to elute from cells carrying receptors but binding was abolished in the presence of the two HA sugars in the sialylated form (Ohuchi et al., 1997Go). Thus, the biological activity of HA, the binding to and dissociate from its receptor, is regulated by two carbohydrates. These observations demonstrate that besides the various functions of carbohydrates, like the stabilization of protein conformations and the protection against proteolytic degradation, sugars have direct effect on the affinity of, for example, viral glycoproteins to their cellular receptors.

In summary, our studies on genetically engineered NL4-3 mutants demonstrate that carbohydrates within and around the V3 loop are shielding the CXCR4 binding region of HIV-1. The loss of two carbohydrates increases CXCR4-specific infectivity, which is a competitive advantage against other virus mutants. This becomes important during progression of HIV infection to AIDS when the virus faces a drastically compromised immune system. Normally, these mutants are eliminated by the immune response because the deglycosylated V3 loop is much more accessible to neutralizing antibodies. In fact, such mutants can be detected as dominant species in AIDS patients (Schreiber et al., unpublished observations).


    Materials and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
Plasmid constructs
A unique BstEII restriction site was introduced by site directed mutagenesis into the NL4-3 env gene using a synthetic oligonucleotide (5'-AGAC GG TGA CCC ACA ATT TTT CTG TAG C-3') (Adachi et al., 1986Go). The BstEII site at position 6325 allows the replacement of the NL4-3 env gene by BstEII and BamHI cleavage. For the cloning of various V3 mutants we used NheI at position 7250, a unique restriction site in the BstEII–BamHI fragment which is located downstream of the V3 region (Figure 1). We also introduced a unique XbaI site at position 7214 and deleted the BglII site at position 7611 to get a unique BglII site upstream of the V3 region at position 7031. The introduction or deletion of restriction sites by a non-coding change had no effect on the replication capacity of the BstEII containing virus compared to NL4-3 wild type. Using BglII and NheI on either site of the V3 loop allows the replacement of the 225 bp fragment containing the V3 region. For further cloning of V3 mutants we have replaced the 189 bp BglII-XbaI env fragment by a 25 bp synthetic DNA fragment containing a unique AscI restriction site (AGATCTATAGGCGCGCCATTCTAGA (Figure 1).

Cloning of V3 loop mutants
To replace the BglII–NheI 225 bp fragment containing the V3 region we synthesized two oligonucleotides of 144 bases length with a 31 base pair overlap (pNL4-3 env positions 7016 to 7273). Oligonucleotides were hybridized and PCR amplified using BglII and NheI primers (BglII: 5'- GTA ATT AGA TCT GCC AAT TTC ACA GAC; NheI: 5'-TAA TTT GCT AGC TAT CTG TTT TAA AGT G). Glycosylation sites g13 and g17 (see Figure 1), were mutated by changing the codon for Asn (AAC) into the codon for Gln (CAA) (Reitter et al., 1998Go). Glycosylation site g15 was mutated by changing the 3 codons for Asn (AACAACAAT) into GGATCTACA, encoding Gly-Ser-Thr, a mutated glycosylation site identified in V3 sequences of patient isolates (Schreiber et al., 1994Go). Using chemical DNA synthesis and PCR we generated four DNA fragments lacking the glycosylation sites g13/15, g13/17, g15/17, and g13/g15/g17. The sites g13 and g15 are located within the BglII–XbaI fragment whereas site g17 is located within the XbaI–NheI fragment. To generate all possible eight combinations of the three glycosylation sites, the four remaining clones were generated by crossing BglII–XbaI and XbaI–NheI fragments. To generate the respective proviral plasmids, BstEII–BamHI fragments were isolated from the pUCenv constructs and were cloned into the BstEII and BamHI sites of the pNL4-3-Bst vector (Figure 1).

Transfection of cells
Vector pNL4-3-Bst DNA of the respective glycosylation mutant was isolated from XL-1 bacteria by standard procedure (Qiagen, Endo Free Plasmid Maxi Kit). DNA was transfected into Hela cells using the calcium phosphate technique (Chen and Okayama, 1987Go). Hela supernatants were used for the infection of IL-2 and PHA stimulated PBMC.

Cell culture
Hela-P4 cells were grown in Dulbecco’s modified Eagle medium (DMEM) (Life Technologies, Karlsruhe, Germany) containing 10% fetal calf serum (FCS) (Biochrom KG, Berlin, Germany). PBMC were obtained from HIV negative donors and isolated by Ficoll-Paque gradient centrifugation. PBMC were prestimulated with 5 µg/ml phytohemagglutinin (both from Biochrom KG, Berlin, Germany) and then cultivated in RPMI medium containing 10% fetal calf serum, and 100 U/ml of interleukin 2 (Chiron GmbH, Ratingen, Germany). Stimulated PBMC were infected with Hela cell culture supernatants and virus production was measured by a standard p24 assay (Moore et al., 1990Go). To test the coreceptor usage human osteosarcoma (GHOST) indicator cell lines (provided by D.Littman) were cultured in DMEM supplemented with 10% fetal calf serum. The parental GHOST cell clone expressing human CD4 was grown under G418 selection (500 µg/ml; Life Technologies GmbH, Karlsruhe, Germany). GHOST cells expressing one of the coreceptors CCR3, CCR5, CCR8, BOB, Bonzo, or CXCR4 were cultivated in medium additionally supplemented with puromycin (1 µg/ml; Sigma, Deisenhofen, Germany).

Evaluation of coreceptor usage
The p24 immunostaining of infected cells was performed as described earlier (Chesebro and Wehrly, 1988Go; Clapham et al., 1992Go). In brief, infected cells were grown in Dulbecco’s modified medium containing 10% fetal calf serum for 4 days, washed in phosphate-buffered saline (PBS), and fixed using methanol-acetone (–20°C, 1:1). For p24 detection a mixture of two mouse monoclonal anti-p24 antibodies (EVA365, EVA366, provided by the MRC AIDS reagent project) was applied at a dilution of 1:400. Bound antibody was detected using goat anti-mouse IgG antibodies conjugated to {beta}-galactosidase (1:100 dilution, Biozol, Germany). Staining was performed using 0.5 mg x-gal (5-bromo-4-chloro-3-{beta}-D-galactosidase) per ml PBS containing 3 mM potassium ferrocyanide, 3 mM potassium ferricyanide, and 1 mM magnesium chloride for 1–2 h at room temperature. Stained blue cell clusters were counted and expressed as foci forming units (ffu). Infection was blocked by adding SDF-1.

Flow cytometry
GHOST indicator cells were stained with anti-CXCR4 monoclonal antibody conjugated to R-phycoerythrin (RPE, Pharmigen, Hamburg, Germany). Cells were incubated with anti-CXCR4-RPE antibody for 15 min at room temperature in 100 µl phosphate-buffered saline (PBS) containing 1% FCS. Cells were washed twice in PBS-1% FCS and twice in PBS, and were resuspended in PBS (1 x 106 cells/500 µl). Fluorescence was measured on a FACSCalibur (Beckton Dickinson).

SDF-1 inhibition
GHOST-CXCR4 cells were incubated with SDF-1 (Strathmann Biotech, Hannover, Germany) 2 h prior to infection. Virus supernatants from IL-2 and PHA stimulated PBMC of NL4-3 mutants containing infectious virions equivalent to 60–100 ffu were used for infection. Cells were washed on day 2 and immunostaining was performed as described above on day 4. Infection of GHOST-CXCR4 cells was expressed as ffu per ml or ffu per ng of p24.

Patient isolates were grown in IL-2 and PHA stimulated PBMC. Virus supernatants containing 50 TCID50 were applied to IL-2 and PHA stimulated HIV-1 negative donor PBMC together with SDF-1. Cells were incubated 18 h at 37°C, washed four times in RPMI 1640. Infection was monitored by standard p24 assay (29) (Aalto Bio Reagents Ltd., Dublin, Ireland).

Three-dimensional model generation
The structures shown in Figure 4 were obtained by homology modeling based on V3 loop NMR data published by Gupta et al. (1993)Go and a glycosylated V3 loop by Meyer et al. (unpublished observations). Modeling and visualization was performed on Silicon Graphics Octane computers using the SYBYL software package. The 3D structure of the individual carbohydrate structures was optimized using the GEGOP program (Stuike-Prill and Meyer, 1990Go). These oligosaccharide structures were then attached to the peptide and subjected a 600 ps MD simulation in a water box. The resulting relaxed structure is shown in Figure 4a,b.


    Acknowledgments
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
We thank Sonja Ziegelmaier and Stefanie Eichler for skillful technical assistance. GHOST indicator cells were kindly provided by D. Littman organized by the Centralised Facility for AIDS Reagents, supported by EU Programme EVA (contract BMH4 97/2515) and the UK Medical Research Council. This work was supported in part by grants to M.S. and B.M. from Sonderforschungsbereich 470 at Hamburg University and by Grant FKZ:01KI 97416/6 from Bundesministerium für Bildung und Forschung to M.S.


    Abbreviations
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
GHOST, osteosarcoma cell line expressing human CD4; GHOST-CXCR4, GHOST cell line expressing CXCR4; HOS-CD4, cell line expressing human CD4; CD4, T cell specific marker, Ig superfamily; PBMC, peripheral blood mononuclear cells; BstEII, BamHI, EcoRI, and NheI, DNA cleaving enzymes; P24,HIV antigen used for HIV monitoring; NL4-3, SF-2, and BRU, HIV-1 molecular clones; pNL4-3, cloning vector containing the NL4-3 genome; CCR5 and CXCR4, chemokine receptors, rhodopsin superfamily; V3 loop, third variable loop of gp120; SDF-1, chemokine, ligand of CXCR4, neutralizes HIV-1; HA, hemagglutinin, glycoprotein.


    Footnotes
 
1 To whom correspondence should be addressed Back


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
Alkhatib, G., Combadiere, C., Broder, C.C., Feng, Y., Kennedy, P.E., Murphy, P.M., and Berger, E.A. (1996) CC CKR5: a RANTES, MIP-1{alpha}, MIP-1{beta} receptor as a fusion cofactor for macrophage-tropic HIV-1. Science, 272, 1955–1958.

Adachi, A., Gendelman, H.E., Koenig, S., Folks, T., Willey, R., Rabson, A., and Martin, M. A. (1986) Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. J. Virol., 59, 284–291.

Back, N.K., Smit, L., De Jong, J.-J., Keulen, W., Schutten, M., Goudsmit, J., and Tersmette, M. (1994) An N-glycan within the human immunodeficiency virus type 1 gp120 V3 loop affects virus neutralization. Virology, 199, 431–438.

Bandres, J.C., Wang, Q.F., O’Leary, J., Baleaux, F., Amara, A., Hoxie, J.A., Zolla-Pazner, S., and Gorny, M.K. (1998) Human immunodeficiency virus (HIV) envelope binds to CXCR4 independently of CD4 and binding can be enhanced by interaction with soluble CD4 or by HIV envelope deglycosylation. J. Virol., 72, 2500–2504.

Berger, E.A., Doms, R.W., Fenyo, E.M., Korber, B.T., Littman, D.R., Moore, J.P., Sattentau, Q.J., Schuitemaker, H., Sodroski, J., and Weiss, R.A. (1998) A new classification for HIV-1. Nature, 391, 240.

Chen, C. and Okayama, H. (1987) High-efficiency transformation of mammalian cells by plasmid DNA. Mol. Cell. Biol., 7, 2745–2752.

Cheng-Mayer, C., Brown, A., Harouse, J., Luciw, P.A., and Mayer, A.J. (1999) Selection for neutralization resistance of the simian/human immunodeficiency virus SHIVSF33A variant in vivo by virtue of sequence changes in the extracellular envelope glycoprotein that modify N-linked glycosylation. J. Virol., 73, 5294–5300.

Chesebro, B. and Wehrly, K. (1988) Development of a sensitive quantitative focal assay for human immunodeficiency virus infectivity. J. Virol., 62, 3779–3788.

Choe, H., Farzan, M., Sun, Y., Sullivan, N., Rollins, B., Ponath, P.D., Wu, L., Mackay, C.R., LaRosa, G., Newman, W., Gerard, N., Gerard, C., and Sodroski, J. (1996) The {beta}-chemokine receptors CCR3 and CCR5 facilitate infection by primary HIV-1 isolates. Cell, 85, 1135–1148.

Clapham, P.R., McKnight, A., and Weiss, R.A. (1992) Human immunodeficiency virus type 2 infection and fusion of CD4-negative human cell lines: induction and enhancement by soluble CD4. J. Virol., 66, 3531–3537.

Cocchi, F., DeVico, A.L., Garzino-Demo, A., Cara, A., Gallo, R.C., and Lusso, P. (1996) The V3 domain of the HIV-1 gp120 envelope glycoprotein is critical for chemokine-mediated blockade of infection. Nature Med., 2, 1244–1247.

Connor, R.I., Sheridan, K.E., Ceradini, D., Choe, S., and Landau, N.R. (1997) Change in coreceptor use coreceptor use correlates with disease progression in HIV-1-infected individuals. J. Exp. Med., 185, 621–628.

Dalgleish, A.G., Beverley, P.C., Clapham, P.R., Crawford, D.H., Greaves, M.F., and Weiss, R.A. (1984) The CD4 (T4) antigen is an essential component of the receptor for the AIDS retrovirus. Nature, 312, 763–767.

De Jong, J.-J., DeRonde, A., Keulen, W., Tersmette, M., and Goudsmit, J. (1992) Minimal requirements for the human immunodeficiency virus type 1 V3 domain to support the syncytium-inducing phenotype: analysis by single amino acid substitution. J. Virol., 66, 6777–6780.

Deng, H., Liu, R., Ellmeier, W., Choe, S., Unutmaz, D., Burkhart, M., Di Marzio, P., Marmon, S., Sutton, R.E., Hill, C.M., and others. (1996) Identification of a major co-receptor for primary isolates of HIV-1. Nature, 381, 661–666.

Doranz, B.J., Rucker, J., Yi, Y., Smyth, R.J., Samson, M., Peiper, S.C., Parmentier, M., Collman, R.G., and Doms, R.W. (1996) A dual-tropic primary HIV-1 isolate that uses fusin and the {beta}-chemokine receptors CKR-5, CKR-3 and CKR-2b as fusion cofactors. Cell, 85, 1149–1158.

Dragic, T., Litwin, V., Allaway, G.P., Martin, S.R., Huang, Y., Nagashima, K.A., Cayanan, C., Maddon, P.J., Koup, R.A., Moore, J.P., and Paxton, W.A. (1996) HIV-1 entry into CD4+ cells is mediated by the chemokine receptor CC-CKR-5. Nature, 381, 667–673.

Ezekowitz, R.A.B., Kuhlman, M., Groopmann, J.E., and Byran, R.A. (1989) A human serum mannose-binding protein inhibits in vitro infection by the human immunodeficiency virus J. Exp. Ed., 169, 185–196.

Feizi, T. and Larkin, M. (1990) AIDS and glycosylation. Glycobiology 1, 17–23.

Feng, Y., Broder, C.C., Kennedy, P.E., and Berger, E.A. (1996) HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G protein-coupled receptor. Science, 272, 872–877.

Fenouillet, E., Gluckman, J.C., and Bahraoui, E. (1990) Role of N-linked glycans of envelope glycoproteins in infectivity of human immunodeficiency virus type 1. J. Virol., 64, 2841–2848.

Goudsmit, J. (1995) The role of viral diversity in HIV pathogenesis. J. Acquir. Immune. Defic. Syndr. Hum. Retrovirol. Suppl., 1, S15–S19.

Gupta, G., Anantharamaiah, G.M., Scott, D.R., Eldridge, J.H., and Myers, G. (1993) Solution structure of the V3 loop of a Thailand HIV isolate. J. Biomol. Struct. Dyn., 11, 345–366.

Hoffman, T.L., LaBranche, C.C., Zhang, W., Canziani, G., Robinson, J., Chaiken, I., Hoxie, J.A., and Doms, R.W. (1999) Stable exposure of the coreceptor-binding site in a CD4-independent HIV-1 envelope protein. Proc. Natl. Acad. Sci. USA, 96, 6359–6364.

Korber, B., Kuiken, C., Foley, B., Hahn, B., McCutchan, F., Mellors, J., and Sodroski, J. (1998) Human Retroviruses and AIDS. Los Alamos National Laboratory, Los Alamos, New Mexiko, USA.

Kuiken, C.L., de Jong, J.-J., Baan, E., Keulen, W., Tersmette, M., and Goudsmit, J. (1992) Evolution of the V3 envelope domain in proviral sequences and isolates of human immunodeficiency virus type 1 during transition of the viral biological phenotype. J. Virol., 66, 4622–4627.

Kwong, P.D., Wyatt, R., Sattentau, Q.J., Sodroski, J., and Hendrickson, W.A. (2000) Oligomeric modeling and electrostatic analysis of the gp120 envelope glycoprotein of human immunodeficiency virus. J. Virol., 74, 1961–1972.

Larkin, M., Childs, R.A., Matthews, T.J., Thiel, S., Mizuochi, T., Lawson, A.M., Savill, J.S., Haslett, C., Diaz, R., and Feizi, T. (1989) Oligosaccaride-mediated interactions of the envelope glycoprotein gp120 of HIV-1 that are independent of CD4 recognition. AIDS, 3, 797–798.

Lee, B., Sharron, M., Montaner, L.J., Weissman, D., and Doms, R.W. (1999) Quantification of CD4, CCR5 and CXCR4 levels on lymphocyte subsets, dendritic cells and differentially conditioned monocyte-derived macrophages. Proc. Natl. Acad. Sci. USA, 96, 5215–5220.

Leonard, C.K., Spellman, M.W., Riddle, L., Harris, R.J., Thomas, J.N., and Gregory, T.J. (1990) Assignment of intrachain disulfide bonds and characterization of potential glycosylation sites of the type 1 recombinant human immunodeficiency virus envelope glycoprotein (gp120) expressed in Chinese hamster ovary cells. J. Biol. Chem., 265, 10373–10382.

Liedtke, S., Geyer, R., and Geyer, H. (1997) Host-cell-specific glycosylation of HIV-2 envelope glycoprotein. Glycoconj. J., 14, 785793.

Losman, B., Biller, M., Olofsson, S., Schonning, K., Lund, O.S., Svennerholm, B., Hansen, J.E., and Bolmstedt, A. (1999) The N-linked glycan of the V3 region of HIV-1 gp120 and CXCR4-dependent multiplication of a human immunodeficiency virus type 1 lymphocyte-tropic variant. FEBS Lett., 454, 47–52.

Manca, F. (1992) Galactose receptors and presentation of HIV envelope glycoprotein to specific human T cells. J. Immunol., 148, 2278–2282.

Milich, L., Margolin, B., and Swanstrom, R. (1993) V3 loop of the human immunodeficiency virus type 1 Env protein: interpreting sequence variability. J. Virol., 67, 5623–5634.

Moore, J.P., McKeating, J.A., Weiss, R.A., and Sattentau, Q.J. (1990) Dissociation of gp120 from HIV-1 virions induced by soluble CD4. Science, 250, 1139–1142.

Moulard, M., Lortat-Jacob, H., Mondor, I., Roca, G., Wyatt, R., Sodroski, J., Zhao, L., Olson, W., Kwong, P.D., and Sattentau, Q.J. (2000) Selective interactions of polyanions with basic surfaces on human immunodeficiency virus type 1 gp120. J. Virol., 74, 1948–1960.

Nakayama, E.E., Shioda, T., Tatsumi, M., Xin, X., Yu, D., Ohgimoto, S., Kato, A., Sakai, Y., Ohnishi, Y., and Nagai, Y. (1998) Importance of the N-glycan in the V3 loop of HIV-1 envelope protein for CXCR-4- but not CCR-5-dependent fusion. FEBS Lett., 426, 367–372.

Ohuchi, M., Ohuchi, R., Feldmann, A., and Klenk, H.-D. (1997) Regulation of receptor binding affinity of influenza virus hemagglutinin by its carbohydrate moiety. J. Virol., 71, 8377–8384.

Pfeiffer, G., Strube, K.H., Schmidt, M., and Geyer, R. (1994) Glycosylation of two recombinat human uterine tissue plasminogen activators variants carrying an additional N-glycosylation site in the epidermal-groth-factor-like domain. Eur. J. Biochem. 219, 331–348.

Reitter, J.N., Means, R.E., and Desrosiers, R.C. (1998) A role for carbohydrates in immune evasion in AIDS. Nature Med., 4, 679–684.

Rodrigo, A.G. (1997) Dynamics of syncytium-inducing and non-syncytium-inducing type 1 human immunodeficiency viruses during primary infection. AIDS Res. Hum. Retroviruses, 13, 1447–1451.

Rusche, J. R., Javaherian, K., McDanal, C., Petro, J., Lynn, D.L., Grimaila, R., Langlois, A., Gallo, R.C., Arthur, L.O., Fischinger, P.J., Bolognesi, D.P., Putney, S.D., and Matthews, T.J. (1988) Antibodies that inhibit fusion of human immunodeficiency virus-infected cells bind a 24-amino acid sequence of the viral envelope, gp120. Proc. Natl Acad. Sci. USA, 85, 3198–3202.

Saag, M.S., Hammer, S.M., and Lange, J.M. (1994) Pathogenicity and diversity of HIV and implications for clinical management: a review. J. Acquir. Immune. Defic. Syndr., 2, S2–S10.

Sakaida, H., Hori, T., Yonezawa, A., Sato, A., Isaka, Y., Yoshie, O., Hattori, T., and Uchiyama, T. (1998) T-tropic human immunodeficiency virus type 1 (HIV-1)-derived V3 loop peptides directly bind to CXCR-4 and inhibit T-tropic HIV-1 infection. J. Virol., 72, 9763–9770.

Schonning, K., Jansson, B., Olofsson, S., Nielsen, J.O., and Hansen, J.S. (1996a) Resistance to V3-directed neutralization caused by an N-linked oligosaccharide depends on the quaternary structure of the HIV-1 envelope oligomer. Virology, 18, 134–140.

Schonning, K., Jansson, B., Olofsson, S., and Hansen, J.E. (1996b) Rapid selection for an N-linked oligosaccharide by monoclonal antibodies directed against the V3 loop of human immunodeficiency virus type 1. J. Gen. Virol., 77, 753–758.

Schreiber, M., Petersen, H., Wachsmuth, C., Müller, H., Hufert, F.T., and Schmitz, H. (1994) Antibodies of symptomatic human immunodeficiency virus type 1-infected individuals are directed to the V3 domain of noninfectious and not of infectious virions present in autologous serum. J. Virol., 68, 3908–3916.

Spijkerman, I., de Wolf, F., Langendam, M., Schuitemaker, H., and Coutinho, R. (1998) Emergence of syncytium-inducing human immunodeficiency virus type 1 variants coincides with a transient increase in viral RNA level and is an independent predictor for progression to AIDS. J. Infect. Dis., 178, 397–403.

Stuike-Prill, R., and Meyer, B. (1990) A new force-field program for the calculation of glycopeptides and its application to a heptacosapeptide-decasaccharide of immunoglobulin G1. Importance of 1–6-glycosidic linkages in carbohydrate.peptide interactions. Eur. J. Biochem., 194, 903–919

Wyatt, R., Kwong, P.D., Desjardins, E., Sweet, R.W., Robinson, J., Hendrickson, W.A., and Sodroski, J.G. (1998) The antigenic structure of the HIV gp120 envelope glycoprotein. Nature, 393, 705–711

Zhang, L., He, T., Huang, Y., Chen, Z., Guo, Y., Wu, S., Kunstman, K.J., Brown, R.C., Phair, J.P., Neumann, A.U., Ho, D.D., and Wolinsky, S.M. (1998) Chemokine coreceptor usage by diverse primary isolates of human immunodeficiency virus type 1. J. Virol., 72, 9307–9312.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Lipid Res.Home page
R. J. Brown, G. C. Miller, N. Griffon, C. J. Long, and D. J. Rader
Glycosylation of endothelial lipase at asparagine-116 reduces activity and the hydrolysis of native lipoproteins in vitro and in vivo
J. Lipid Res., May 1, 2007; 48(5): 1132 - 1139.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
P. Clevestig, L. Pramanik, T. Leitner, and A. Ehrnst
CCR5 use by human immunodeficiency virus type 1 is associated closely with the gp120 V3 loop N-linked glycosylation site.
J. Gen. Virol., March 1, 2006; 87(Pt 3): 607 - 612.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
D. Luftenegger, M. Picard-Maureau, N. Stanke, A. Rethwilm, and D. Lindemann
Analysis and Function of Prototype Foamy Virus Envelope N Glycosylation
J. Virol., June 15, 2005; 79(12): 7664 - 7672.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Bardor, D. H. Nguyen, S. Diaz, and A. Varki
Mechanism of Uptake and Incorporation of the Non-human Sialic Acid N-Glycolylneuraminic Acid into Human Cells
J. Biol. Chem., February 11, 2005; 280(6): 4228 - 4237.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. Gordon, T. De Oliveira, K. Bishop, H. M. Coovadia, L. Madurai, S. Engelbrecht, E. Janse van Rensburg, A. Mosam, A. Smith, and S. Cassol
Molecular Characteristics of Human Immunodeficiency Virus Type 1 Subtype C Viruses from KwaZulu-Natal, South Africa: Implications for Vaccine and Antiretroviral Control Strategies
J. Virol., February 15, 2003; 77(4): 2587 - 2599.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (19)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Polzer, S.
Right arrow Articles by Schreiber, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Polzer, S.
Right arrow Articles by Schreiber, M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?