Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (21)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Albermann, C.
Right arrow Articles by Piepersberg, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Albermann, C.
Right arrow Articles by Piepersberg, W.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Glycobiology, 2000, Vol. 10, No. 9 875-881
© 2000 Oxford University Press

Preparative synthesis of GDP-ß-L-fucose by recombinant enzymes from enterobacterial sources

Christoph Albermann, Jürgen Distler and Wolfgang Piepersberg1

Chemische Mikrobiologie, Bergische Universität Wuppertal, Germany

Received on January 18, 2000; revised on March 8, 2000; accepted on March 17, 2000.


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
The 6-deoxyhexose L-fucose is an important and characteristic element in glycoconjugates of bacteria (e.g., lipopolysaccharides), plants (e.g., xyloglucans) and animals (e.g., glycolipids, glycoproteins, and oligosaccharides). The biosynthetic pathway of GDP-L-fucose starts with a dehydration of GDP-D-mannose catalyzed by GDP-D-mannose 4,6-dehydratase (Gmd) creating GDP-4-keto-6-deoxymannose which is subsequently converted by the GDP-4-keto-6-deoxy-D-mannose 3,5-epimerase-4-reductase (WcaG; GDP-ß-L-fucose synthetase) to GDP-ß-L-fucose. Both biosynthetic genes gmd and wcaG were cloned from Escherichia coli K12 and the enzymes overexpressed under control of the T7 promoter in the expression vectors pET11a and pET16b, yielding both native and N-terminal His-tag fusion proteins, respectively. The activities of the Gmd and WcaG were analyzed. The enzymatic conversion from GDP-D-mannose to GDP-ß-L-fucose was optimized and the final product was purified. The formation of GDP-ß-L-fucose by the recombinant enzymes was verified by HPLC and NMR analyses. The His-tag fusion variants of the Gmd and WcaG proteins were purified to near homogeneity. The His-tag Gmd recombinant enzyme was inactive, whereas His-tag WcaG showed very similar enzymatic properties relative to the native GDP-ß-L-fucose synthetase. With the purified His-tag WcaG Km and Vmax values, respectively, of 40 µM and 23 nkat/mg protein for the substrate GDP-4-keto-6-deoxy-D-mannose and of 21 µM and 10 nkat/mg protein for the cosubstrate NADPH were obtained; a pH optimum of 7.5 was determined and the enzyme was stimulated to equal extend by the divalent cations Mg2+ and Ca2+. The Gmd enzyme showed a strong feedback inhibition by GDP-ß-L-fucose.

Key words: GDP-ß-L-fucose/enzymatic synthesis/6-deoxyhexose/GDP-D-mannose 4,6-dehydratase/GDP-4-keto-6-deoxy-D-mannose 3,5-epimerase-4-reductase (= GDP-ß-L-fucose synthetase)


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
L-fucose, a 6-deoxy-L-galactose, is used as an important component of highly modified oligosaccharidic side chains in so-called glycoconjugates. This type of 6-deoxyhexose occurs almost ubiquitously in microorganisms, plants and animals; however, it is not found in every microorganismal strain of a particular taxonomical group. The introduction of this monosaccharidic unit into the glycosylated end products in both pro- and eukaryotes is dependent on nucleotide activation as a GDP-hexose and modification of the sugar molecule in this form which results in the substrate for fucosyltransferases. The characteristic biosynthetic pathway for GDP-L-fucose basically follows that of other 6-deoxyhexoses, which are made via the dTDP- or CDP-activated sugars, and start with a dehydration reaction catalyzed by an NAD+-dependent NDP-hexose 4,6-dehydratase that forms NDP-6-deoxy-D-4-hexulose (Liu and Thorson, 1994Go; Piepersberg, 1994Go; Piepersberg and Distler, 1997Go). By further reactions this intermediate can be modified by a large variety of following steps, e.g., the 4-carbonyl group can become be enantioselectively reduced, transaminated or be fully reduced. In other cases the NDP-6-deoxy-D-4-hexuloses are converted first by an 3,5-epimerase reaction to NDP-6-deoxy-L-4-hexulose.

In the case of GDP-ß-L-fucose the activated sugar metabolite is formed from mannose-6-phosphate in five steps (Figure 1). After the conversion of mannose-6-phosphate to mannose-1-phosphate, catalyzed by the mutase ManB (D-mannose-6-phosphate ketol isomerase; E.C. 5.3.1.8), and the nucleotide activation, catalyzed by the GDP-{alpha}-D-mannose synthase ManC (GTP:{alpha}-D-mannose-1-phosphate guanylyltransferase; E.C. 2.7.7.13), the formed intermediate GDP-{alpha}-D-mannose is processed to GDP-ß-L-fucose in three further steps which are catalyzed by two enzymes (Chang et al., 1988Go; Tonetti et al., 1996Go; Andrianopoulos et al., 1998Go): GDP-{alpha}-D-mannose is converted into GDP-4-keto-6-deoxy-D-mannose by GDP-D-mannose 4,6-dehydratase Gmd (GDP-D-mannose 4,6-hydro-lyase; E.C. 4.2.1.47), followed by an epimerization and a final reduction step to give GDP-ß-L-fucose catalyzed by the bifunctional GDP-4-keto-6-deoxy-D-mannose 3,5-epimerase-4-reductase WcaG (GDP-L-fucose synthetase; E.C. not yet classified).



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 1. Biosynthetic pathway of GDP-ß-L-fucose. The steps are catalyzed by the following enzymes: (1) Phosphomannomutase (ManB), (2) GDP-{alpha}-D-mannose pyrophosphorylase (ManC), (3) GDP-{alpha}-D-mannose 4,6-dehydratase (Gmd), (4) GDP-4-keto-6-deoxy-{alpha}-D-mannose 3,5-epimerase-4-reductase (WcaG).

 
Fucosylation is the terminal and critical step in the in vivo synthesis of many biologically important oligosaccharide side chains in glycoproteins and glycolipids (Chan et al., 1995Go; Becker and Lowe, 1999Go). Several fucosyltransferases from pro- and eukaryotes have been cloned and their properties were studied (Ge et al., 1997Go; Guo and Wang, 1997Go; Hokke et al., 1998Go). Some of these enzymes have already been used for in vitro fucosylation reactions, e.g., the human {alpha}-1,2-fucosyltransferase (EC 2.4.1.69), {alpha}-1,3-fucosyltransferase and {alpha}-1,3/4-fucosyltransferase (EC 2.4.1.65) (Guo and Wang, 1997Go; Nimtz et al., 1998Go); but one of the limiting factors of a large scale application is the availability of GDP-ß-L-fucose. This nucleotide sugar is currently produced in an expensive chemical synthesis, which is not efficient enough in order to meet the demand for larger scale synthesis of important glycoconjugates (Gokhale et al., 1990Go; Schmidt et al., 1991Go). Other nucleotide-activated sugars, e.g., GDP-D-mannose or dTDP-L-rhamnose, have already been synthesized fully on the basis of enzymatic reactions (Elling et al., 1996Go) with the respective enzymes overproduced in a suitable expression system such as Escherichia coli. In this report we describe the cloning and the overproduction of the proteins Gmd (GDP-D-mannose 4,6-dehydratase) and WcaG (GDP-L-fucose synthetase) from E.coli K12. We present evidence that the final product of the coupled enzymatic reactions catalyzed by Gmd and WcaG is GDP-ß-L-fucose. Also, the formation of N-terminally His-tag elongated variants of both proteins and their purification and a characterization of the WcaG-protein is described.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
Cloning and expression of GDP-D-mannose 4,6-dehydratase and GDP-L-fucose synthetase
The two tandem genes gmd and wcaG of the colanic acid biosynthesis cluster of Escherichia coli strain K-12 (Aoyama et al., 1994Go; Stevenson et al., 1996Go), which encode the putative GDP-D-mannose 4,6-dehydratase and the GDP-L-fucose synthetase, respectively, were amplified and modified by PCR in order to introduce each an N-terminal NdeI, overlapping the ATG start codon, and a downstream BamHI restriction site downstream the stop codon. These were used to insert the three PCR-products, containing the single and the combined genes, were cloned into the expression vector pET11a and verified by sequence analysis. The single genes were additionally cloned into the pET16b expression vector to obtain their products as N-terminal His-tag fusion proteins. The plasmids pCAW21.1 (gmd), pCAW21.2 (His-tag gmd), pCAW22.1 (wcaG), pCAW22.2 (His-tag wcaG), and pCAW23 (gmd-wcaG) constructed this way were transformed in E.coli BL21 (DE3) pLysS, where their expression under induced conditions resulted in the overproduction of large amounts of Gmd and WcaG proteins (Figure 2). The apparent molecular masses in analyses by SDS–polyacrylamide gel electrophoresis (SDS–PAGE) agreed with the calculated masses of the proteins (Gmd 42 kDa; His-tag Gmd 44.5 kDa; WcaG 36 kDa; His-tag WcaG 38.5 kDa).



View larger version (119K):
[in this window]
[in a new window]
 
Fig. 2. SDS–PAGE analysis of crude extracts from non-induced and induced recombinant E.coli strains. The following protein patterns are shown in the lanes: (1) Low molecular weight marker; (2) BL21 pLysS pET11a, 1 min after induction; (3 and 13) BL21 pLysS pET11a, 90 min after induction; (4) S30 of BL21 pLysS pET11a; (5) BL21 pLysS pCAW21.1 (gmd), 1 min after induction; (6) BL21 pLysS pCAW21.1 (gmd), 90 min after induction; (7) S30 of BL21 pLysS pCAW21 (gmd), 90 min after induction; (8) high molecular weight marker; (9) BL21 pLysS pCAW22.1 (wcaG), 1 min after induction; (10) BL21 pLysS pCAW22.1 (wcaG), 90 min after induction; (11) BL21 pLysS pCAW23 (wcaG and gmd), 1 min after induction; (12) BL21 pLysS pCAW23 (wcaG and gmd), 90 min after induction.

 
Purification of the His-tag fusion proteins
The proteins His-tag Gmd and His-tag WcaG were purified separately, but with the same strategy. After harvesting of E.coli BL21 (DE3) pLysS cells containing the plasmids pCAW21.2 or pCAW22.2, respectively, the cell-free extracts were prepared and the crude extracts were chromatographed on a Ni-NTA-agarose column, which bound the His-tag fusion proteins tightly. The elution of the recombinant proteins from the affinity columns was accomplished by increasing the imidazol concentration up to 200 mM. The imidazol was removed from the protein fraction by gel filtration. The eluted fractions each contained one major band in a SDS–PAGE analysis consistent with the calculated molecular masses of His-tag Gmd (44.5 kDa) and of His-tag WcaG (38.5 kDa), respectively.

Enzyme assays and HPLC-analysis
Crude ribosome-free extracts from the recombinant E.coli strains were tested for the activity of GDP-D-mannose 4,6-dehydratase and of GDP-4-keto-6-deoxy-D-mannose 3,5-epimerase-4-reductase (GDP-L-fucose synthetase). The conversion of GDP-{alpha}-D-mannose to GDP-ß-L-fucose was monitored by high pressure liquid chromatography (HPLC) (Figure 4). The His-tag fusion protein variant of Gmd did not show any activity. Only the native Gmd catalyzed the dehydration of GDP-{alpha}-D-mannose. In contrast, the conversion of GDP-4-keto-6-deoxy-D-mannose to GDP-ß-L-fucose both the native WcaG protein and its His-tag fusion variant were catalytically active. In coupled reaction assays, with Gmd and WcaG or His-tag WcaG, the conversion of GDP-{alpha}-D-mannose to GDP-ß-L-fucose is low, on account of the feed-back inhibition of the GDP-D-mannose 4,6-dehydratase, after an incubation time of 90 min, only 19% of the GDP-{alpha}-D-mannose were formed to GDP-ß-L-fucose. A complete formation of GDP-ß-L-fucose, with the active Gmd and WcaG protein in the same "one-pot" assay, could be obtained, if the NADPH Co-enzyme of the GDP-4-keto-6-deoxy-D-mannose 3,5-epimerase-4-reductase was added after the dehydration reaction to GDP-4-keto-6-deoxy-D-mannose.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 4. HPLC analysis of the enzymatic reactions catalyzed by Gmd and WcaG. (A) GDP-{alpha}-D-mannose standard; (B) GDP-ß-L-fucose standard; (C) Gmd catalyzed reaction to GDP-4-keto-6-deoxy-D-mannose (35 min); (D) WcaG catalyzed reaction to GDP-ß-L-fucose (32 min) and NADP+ (44 min); (E) Gmd/WcaG catalyzed reaction to GDP-ß-L-fucose (32 min) after 90 min of incubation, (27 min) GDP-{alpha}-D-mannose, (44 min) NADP+; (F) isolated GDP-ß-L-fucose (32 min) after preparative enzymatic synthesis.

 
The specific activities of the crude extract of E.coli BL21 His-tag WcaG and of the purified His-tag fusion protein in presence of 10 mM MgCl2 and with NADPH as coenzyme were 12 and 29 nkat/mg protein, respectively. This indicated ~2.4-fold enrichment of the purified protein or ~40% of the soluble protein in the induced culture. NADH was also accepted as redox coenzyme, but at a 40% lowered specific activity. In the controls, crude extracts from E.coli BL21 (DE3) pLysS with either vector plasmid, pET11a or pET16b, no Gmd or WcaG-specific activity could be detected under the same conditions.

The Km and Vmax values for the substrate GDP-4-keto-6-deoxy-D-mannose were 40 µM and 23 nkat/mg protein, respectively. The Km and Vmax values for the cosubstrate NADPH were 21 µM and 10 nkat/mg protein, respectively. The reaction catalyzed by the His-tag WcaG protein has its pH optimum at 7.5 (Figure 5). Also, a slight stimulation of activity up to about 1.4- to 1.5-fold is seen after the addition of the divalent cations Ca2+ and Mg2+, an effect which is saturated at about 20 mM in both cases (cf. Figure 5).



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 5. Influence of pH and divalent cations on the activity of the GDP-L-fucose synthetase WcaG. (A) Dependence of the activity of the His-tag WcaG fusion protein on the pH is shown. (B) The effect of various concentrations of Ca2+ or Mg2+ is given.

 
The gel permeation analysis was used to investigate the molecular mass of the native His-tag WcaG fusion protein. The apparent mass of 40 kDa, measured by comparison of the elution volume of the His-tag WcaG peak with those of known molecular weight standards, suggested that the native protein is a monomer since the molecular mass as determined on SDS–PAGE and as calculated from the deduced protein sequence is 38.5 kDa.

Preparative synthesis and isolation of GDP-ß-L-fucose
The overproduced enzyme GDP-D-mannose 4,6-dehydratase (Gmd) and the purified GDP-L-fucose synthetase (His-tag WcaG) were used for a preparative synthesis of GDP-ß-L-fucose. The synthesis was carried out by two steps starting from GDP-{alpha}-D-mannose (100 mg) on the way which is described in Figure 1. On account of the inhibition of GDP-D-mannose 4,6-dehydratase by GDP-ß-L-fucose it was necessary to carry out the enzymatic reaction in two steps. The formation of the products GDP-4-keto-6-deoxymannose and GDP-ß-L-fucose were followed by HPLC. 78 mg of GDP-ß-L-fucose-disodium salt were obtained after isolation by preparative HPLC and purification according to the protocol described in material and methods. The result of 13C-; 31P-; 1H-NMR-spectroscopy proved the structure of the product to be in accord with GDP-ß-fucose. Also, these data corresponded well to the published data for the chemically synthesized GDP-ß-L-fucose (Gokhale et al., 1990Go; Schmidt et al., 1991Go).


    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
The intention of this work was to establish a basis for both the in vitro bulk production of GDP-ß-L-fucose and for an in vivo fucosylation system in a suitable bacterial host. Therefore, as the required tools we here describe the overexpressed L-fucose biosynthetic enzymes Gmd and WcaG from E.coli K12, as well as the purification of GDP-L-fucose-synthetase to homogeneity, and their use for preparative synthesis of GDP-ß-L-fucose from GDP-{alpha}-D-mannose. All the analyses supported that the product of the Gmd and WcaG catalyzed reactions is GDP-ß-L-fucose. In the past GDP-ß-L-fucose has only been produced by an expensive chemical synthesis. Routes for the enzymatic synthesis of quantitative amounts of GDP-{alpha}-D-mannose by use of overexpressed recombinant enzymes had already been described earlier (Elling et al., 1996Go). With the present work we have established a new biochemical way for the synthesis of GDP-ß-L-fucose by use of the two recombinant enzymes, which can easily be used for product amounts up to gram scale. Studies of enzymatic in vivo fucosylation with the obtained nucleotide sugar, which are in progress in our laboratory, yield another application for the enzymatic synthesis of GDP-ß-L-fucose or its products.

The in vitro preparation could not be carried out efficiently in a one-step ("one-pot") reaction system. Rather it had to be carried out by the overproduced proteins Gmd and WcaG in two successive steps. This was necessary, because of the feedback inhibition of the GDP-D-mannose 4,6-dehydratase (Gmd-protein) by the end product of this pathway GDP-ß-L-fucose (Sturla et al., 1997Go). In addition to the Gmd protein from E.coli we have used the overproduced Gmd protein from another enterobacterium, Yersinia enterocolitica (Zhang et al., 1996Go), that shows the same effect (data not shown). Thus, enterobacterial Gmd enzymes seem to be selected for this feature, probably to prevent negative metabolic effects of an accumulation of GDP-ß-L-fucose in the cells. In the first reaction step the GDP-D-mannose is converted almost completely to GDP-4-keto-6-deoxy-D-mannose by GDP-D-mannose-4,6-dehydratase. After stopping Gmd and addition of WcaG the GDP-4-keto-6-deoxy-D-mannose can be converted to GDP-ß-L-fucose in the second reaction. This phenomenon proved the product of the WcaG-catalyzed reaction to be GDP-ß-L-fucose and not GDP-{alpha}-L-fucose, since the latter molecule is not an inhibitor of GDP-D-mannose 4,6-dehydratase (Sturla et al., 1997Go).

The fact that the His-tag Gmd protein was enzymatically inactive is not surprising in view of its dinucleotide-binding pocket installed directly at its N-terminus. Obviously, the multiple His-extender peptide largely affects the protein structure in this area, perhaps by altering the accessibility of the NADP+ binding site. Such, it could prevent the normal function at least in its oxidoreductase functionality. In contrast, in the WcaG protein the His-tag does not prevent the activity of the enzyme, but it obviously prevents the formation of the quaternary structure of a homodimeric enzyme which is observed in case of the native WcaG protein (Rizzi et al., 1998Go). Thus, the multiple His-extender peptide seems to lead to a monomer form of the GDP-ß-L-fucose synthetase, which, however, seems not to be affected in its activity as proven by the correspondence in kinetic data obtained with both enzyme forms.


    Materials and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
Biochemicals
All antibiotics, isopropyl-thiogalactoside, nucleotides, and nucleotide sugars were obtained from Sigma (Deisenhofen, Germany).

Bacterial strains, growth conditions, and media
The bacterial strains used in this study were Escherichia coli DH5{alpha} and E.coli BL21 (DE3) pLysS. Strains of E.coli were grown at 37°C in Luria-Bertani broth (LB) (Miller, 1972Go); for solid media agar–agar in a concentration of 18 g/l was added. Antibiotics were used at the following finial concentrations: ampicillin 100 µg/ml, chloramphenicol 25 µg/ml. For induction of the lac operator IPTG was used at a finial concentration of 24 µg/ml.

Cloning of gmd and wcaG
The DNA-sequence of the wca-gene cluster for the colanic acid biosynthesis in E.coli K12 was described (Stevenson et al., 1996Go). The genes gmd and wcaG were amplified by PCR with Vent polymerase (BioLabs, Schwalbach/Taunus). Chromosomal DNA was prepared from strain E.coli DH5{alpha} as described previously (Wilson, 1988Go). The following primers, used to amplify the genes gmd and wcaG, were designed on the basis of the published sequence (Stevenson et al., 1996Go) and were obtained from MWG (Ebersberg, Germany): for the gmd gene 5'ACAGAGGAATAACATATGTCAAAAGTCGC3' (forward direction); 5'CCAGCAATAAAAGATCTTTGTTTACTCATGC3' (reverse direction); for wcaG 5'ATCGCGCTGGAGTCATACATATGAGTAAAC3' forward; 5'ACGTAAAAAGATCTTTACCCCCGAAA3' reverse; for gmd/wcaG 5'ACAGAGGAATAACATATGTCAAAAGTCGC3' forward; 5'ACGTAAAAAGATCTTTACCCCCGAAA3' reverse. The products of the PCR amplification were digested with NdeI and BglII restriction enzymes (Gibco BRL, Eggenstein, Germany) and ligated (Sambrook et al., 1989Go) into the vectors pET11a and pET16b (Novagen, Madison, WI) which were hydrolyzed with NdeI and BamHI. After ligation with T4-DNA-ligase (BioLabs, Schwalbach/Taunus), the recombinant plasmids pET11a/gmd (pCAW21.1), pET11a/wcaG (pCAW22.1), pET11a/gmd-wcaG (pCAW23), pET16b/gmd (pCAW21.2), pET16b/wcaG (pCAW22.2) were obtained and transformed into competent cells of E.coli DH5{alpha} (Hanahan, 1983Go). The insert structure of each recombinant derivative was verified by restriction analysis and DNA-sequencing. For over-expression of the proteins the recombinant plasmids were retransformed into competent E.coli BL21 (DE3) pLysS (Cohen et al., 1972Go).

DNA sequencing
The sequence of the amplified DNA was determined by the dideoxynucleotide chain-termination method (Sanger et al., 1977Go) using the Thermo Sequenase fluorescent labeled primer cycle sequencing kit with 7-deaza-dGTP (Amersham, Braunschweig, Germany) and an A.L.F.-Express DNA sequencer (Pharmacia, Freiburg, Germany). The sequence of both strands were determined from the DNA of double stranded plasmids prepared by the QIAprep spin miniprep kit (Qiagen, Hilden, Germany).

Overproduction of GDP-D-mannose 4,6-dehydratase (Gmd) and GDP-4-keto-6-deoxy-D-mannose 3,5-epimerase-4-reductase (WcaG)
For the overproduction of Gmd and WcaG, the E.coli BL21 (DE3) pLysS cells with the recombinant plasmids were grown in LB-media to an optical density of 0.6 at 540 nm. The cells were then induced by IPTG for 90 min. Subsequently, the cells were harvested by centrifugation, washed twice in ice-cold 50 mM Tris/HCl-buffer pH 7.5, and suspended in extraction buffer (50 mM Tris/HCl-buffer pH 7.5, 150 mM NaCl, 10 mM MgCl2, 5 mM ß-mercaptoethanol, 5 mM EDTA). After the disruption by sonication the crude extract was clarified by centrifugation at 30,000 x g for 30 min (S30).

Purification of His-tag fusion proteins
The His-tag Gmd and the His-tag WcaG fused proteins were purified as soluble protein by affinity chromatography, using Ni-NTA-agarose (Qiagen, Hilden, Germany) (Le Grice and Grueninger-Leitch, 1990Go; Schmitt et al., 1993Go). The crude extract (containing His-tag WcaG or His-tag Gmd) was loaded on a Ni-NTA-agarose-column (15 mm x 60 mm) which was equilibrated with 50 mM Tris/HCl-buffer pH 7.5 with 150 mM NaCl, 10 mM MgCl2, and 5 mM ß-mercaptoethanol. The loaded column was washed with 50 mM Tris/HCl-buffer pH 7.5 containing 150 mM NaCl, 10 mM MgCl2, 5 mM ß-mercaptoethanol, and 20 mM imidazol. After the elution with 50 mM Tris/HCl-buffer pH 7.5 with 10 mM MgCl2, 5 mM ß-mercaptoethanol, 200 mM imidazol, and 10% glycerol the protein-containing fractions were analyzed by SDS–PAGE (Laemmli, 1970Go) to check the purity and the molecular mass. Subsequently the imidazol was removed by gel filtration with a PD-10 column (Pharmacia, Freiburg, Germany), the column was equilibrated with 50 mM Tris/HCl-buffer pH 7.5 with 10 mM MgCl2, 5 mM ß-mercaptoethanol, 150 mM NaCl, and 10% glycerol.

Characterization of recombinant WcaG
The size of the native His-tag WcaG was performed by size exclusion chromatography on a FPLC system (Pharmacia, Freiburg) with a Superose 12 gel filtration column (Pharmacia, Freiburg). As mobile phase was used a 50 mM Tris/HCl-buffer pH 7.5 containing 150 mM NaCl, at a flow rate 0.5 ml/min. For the calibration curve the following proteins were applied: ribonuclease 13.7 kDa, chymotrypsinogen A 25 kDa, ovalbumin 43 kDa, bovine serum albumin 67 kDa, alcohol dehydrogenase 150 kDa.

High pressure liquid chromatography (HPLC)
NADP+, NADPH, guanosine monophosphate (GMP), guanosine diphosphate (GDP), guanosine triphosphate (GTP), GDP-D-mannose, GDP-4-keto-6-deoxy-D-mannose, and GDP-ß-L-fucose were separated by HPLC and detected by UV-photometry (Beckman, München, Germany) at 260 nm. As mobile phase a phosphate-buffer (30 mM potassium phosphate, pH 6.0; 5 mM tetrabutylammonium hydrogen sulfate, 2% acetonitrile) and acetonitrile was used. As stationary phase a reversed phase column Eurospher ODS18, 5 µm, 250 x 4.6 mm (Knauer, Berlin, Germany) was used (Payne and Ames, 1982Go).

Enzyme assays
For the measurement of the activity of the GDP-D-mannose 4,6-dehydratase, a spectroscopic (Okazaki et al., 1962Go; Kornfeld and Ginsburg, 1966Go) and chromatographic test system was used to estimated the increase of GDP-4-keto-6-deoxy-D-mannose. The standard assay contained 50 mM Tris/HCl-buffer pH 7.5, 10 mM MgCl2, 4 mM GDP-D-mannose, 50 µM NADP+ and different amounts of Gmd or His-tag Gmd-containing crude extract in a finial volume of 100 µl. Protein concentration was determined according to Bradford (1976)Go. The reactions were performed at 37°C and measured at different times between 0 and 60 min. For the photometric analysis, the reaction were stopped by adding 950 µl 100 mM NaOH to 50 µl of the reaction mixture, the solution was further incubated for 20 min at 37°C. After this, the absorption was measured at 320 nm. For the HPLC analysis the probes were boiled and the proteins were removed by centrifugation. The enzyme activity of the GDP-4-keto-6-deoxy-D-mannose 3,5-epimerase-4-reductase was determined by measuring the consumption of NADPH at 340 nm and 37°C. The standard assay contained 50 mM Tris/HCl-buffer pH 7.5, 2 mM GDP-4-keto-6-deoxy-D-mannose, 10 mM MgCl2, different amounts of WcaG or His-tag WcaG and 4 mM NADPH. The reaction was started by the addition of different concentrations of GDP-4-keto-6-deoxy-D-mannose (finial volume 500 µl). Also, the increase of GDP-ß-L-fucose was observed by HPLC analysis.

Synthesis of GDP-ß-L-fucose
The first step of the preparative synthesis of GDP-ß-L-fucose is the conversion of GDP-D-mannose to GDP-4-keto-6-deoxy-D-mannose. The preparative enzyme assay contains 165 µmol (100 mg) GDP-D-mannose, 50 mM Tris/HCl-buffer pH 7.5, 10 mM MgCl2, crude extract of E.coli BL21 pLysS pCAW21.1 with a GDP-D-mannose 4,6-dehydratase activity of 120 nkat in a finial volume of 6 ml. This mixture was incubated for 60 min at 37°C. The proteins were removed by boiling for 1 min and subsequent centrifugation at 10,000 x g for 30 min. The second step of conversion was started by the addition of 200 µmol NADPH and 120 nkat GDP-4-keto-6-deoxy-D-mannose 3,5-epimerase-4-reductase (His-tag WcaG) to the supernatant. Subsequently, the mixture was incubated for a second time at 37°C for 60 min. The GDP-4-keto-6-deoxy-D-mannose 3,5-epimerase-4-reductase was also separated by boiling and subsequent centrifugation. The course of each reaction to GDP-ß-L-fucose was monitored by HPLC analysis.

Isolation of GDP-ß-L-fucose
The purification of GDP-ß-L-fucose from the side products NADP+ and NADPH was done by a preparative HPLC. The chromatography was performed with a Eurospher ODS18 (20 x 250 mm) column (Knauer, Berlin, Germany) under the same conditions as for the analytical chromatography (see High pressure liquid chromatography [HPLC]). GDP-L-fucose-containing fractions were pooled and evaporated to a volume of 12 ml under reduced pressure (20 mbar) at 20–25°C. For the desalting of the preparation a gel filtration on a Sephadex G-10 column (SR 25/100; Pharmacia, Freiburg, Germany), with a total volume of 398 ml, was used and eluted at a flow rate of 1 ml/min. The GDP-ß-L-fucose-containing fractions were detected by UV-absorption, pooled and applied to a membrane anion exchanger Q15 (Sartorius, Göttingen, Germany) by which the GDP-ß-L-fucose preparation was equilibrated against 150 mM NaCl to yield the Na+ form. After another volume reduction by evaporation to a volume of about 12 ml and a further gel filtration (Sephadex G-10 column), the sodium GDP-ß-L-fucose was lyophilized (Cryograph LCD-1, Christ, Osterrode, Germany) (yield 78 mg).

The enzymatically synthesized GDP-ß-L-fucose was analyzed by NMR-spectroscopy: 1H-NMR (400 MHz, D2O) {delta} (p.p.m.) = 1,1 (d, H-6'', 3J5''6''= 6,4 Hz); 3,55 (dd H-2'', 3J2''3'' = 11 Hz, 3J1''2''= 8,1 Hz); 3,65 (dd, H-3''; 3J3''4'' = 3,5 Hz, 3J2''3'' = 11 Hz); 3,71 (m, H-4'', 3J3''4'' = 3,5); 3,75 (m, H-5''); 4,2 (m, 2H, H-5a'H-5b'); 4,52 (m, H-4'); 4,59 (dd, H-3'); 4,8 (dd, H-2', 3J1'2'= 6,1 Hz, 3J2'3'= 3,7 Hz); 4,91 (dd, H-1'', 3J1''2'' = 8,1 Hz,3JP-2H1'' = 8,3); 5,9 (d, H-1', 3J1'2'= 6,1 Hz ); 8,1 (s, H-1).

13C-NMR (400 MHz, D2O) {delta} (p.p.m.) = 17,5 C'-6''; 33,2 C-2'; 64,6 C-5'; 73,1 73,2 72,5 C-3'' C-4'' C-5'; 74,5 C-3''; 75,8 C-2''; 100,4 C-1''; 118,3 C-5; 139,6 C-1; 153,9 C-4; 156,2 C-2; 161,2 C-6.

31P-NMR (400 MHz, D2O) {delta} (p.p.m.) = – 9,7 (P-1, 2JPP = 19,9 Hz); – 11,5 (P-2, 2Jpp = 19,9 Hz, 3JP-2H-1''= 8,3 Hz).

For reference, the published 1H-NMR data of bis(triethylammonium)-ß-L-fucopyranosyl guanosine-5'-pyrophosphate could be used (Gokhale et al., 1990Go; Schmidt et al., 1991Go).


    Acknowledgments
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
We thank S.Kuberski for expert technical assistance. We are grateful to M.Skurnik for providing DNA of Yersinia enterocolitica. This work was supported by a grant from Roche Diagnostics, Penzberg (Germany).


    Abbreviations
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
HPLC, high performance liquid chromatography; IPTG, isopropylthiogalactoside; PCR, polymerase chain reaction; SDS–PAGE, sodium dodecyl sulfate–polyacrylamide gel electrophoresis.



View larger version (101K):
[in this window]
[in a new window]
 
Fig. 3. Purification of the His-tag Gmd and His-tag WcaG proteins. The SDS–PAGE analysis of the following protein fractions is shown in the lanes: (1) low molecular weight marker; (2) S30 of BL21 pLysS pCAW21.1 (native Gmd); (3) S30 of BL21 pLysS pCAW21.2 (His-tag Gmd); (4) His-tag Gmd after purification on Ni-NTA-agarose; (5) S30 of BL21 pLysS pCAW22.1 (native WcaG); (6) S30 of BL21 pLysS pCAW22.2 (His-tag WcaG); (7) His-tag WcaG after purification by Ni-NTA-agarose.

 

    Footnotes
 
1 To whom correspondence should be addressed at: Bergische Universität GH Wuppertal, FB9—Chemische Mikrobiologie, Gauss-Strasse 20, D-42097 Wuppertal, Germany Back


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
Andrianopoulos,K., Wang,L. and Reeves,P.R. (1998) Identification of the fucose synthetase gene in the colanic acid gene cluster of Escherichia coli K-12. J. Bacteriol., 180, 998–1001.[Abstract/Free Full Text]

Aoyama,K., Haase,A.M. and Reeves,P.R. (1994) Evidence for effect of random genetic drift on G+C content after lateral transfer of fucose pathway genes to Escherichia coli K-12. Mol. Biol. Evol., 11, 829–838.[Abstract]

Becker,D.J. and Lowe,J.B. (1999) Leukocyte adhesion deficiency type II. Biochim. Biophys. Acta, 1455, 193–204.[Medline]

Bradford,M.M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem., 72, 248–254.[Web of Science][Medline]

Chan,N.W.C., Stangier,K., Sherburne,R., Taylor,D.E., Zhang,Y., Dovichi,J. and Palcic,M.M. (1995) The biosynthesis of Lewis x in Helicobacter pylori. Glycobiol., 5, 683–688.

Chang,S., Duerr,B. and Serif,G. (1988) An epimerase-reductase in L-fucose synthesis. J. Biol. Chem., 263, 1693–1697.[Abstract/Free Full Text]

Cohen,S.N., Chang,A.C.Y. and Hsu,L. (1972) Nonchromosomal antibiotic resistance in bacteria: genetic transformation of Escherichia coli by R-factor DNA. Proc. Natl. Acad. Sci. USA, 69, 2110–2114.[Abstract/Free Full Text]

Elling,L., Ritter,J.E. and Verseck,S. (1996) Expression, purification and characterization of recombinant phosphomannomutase and GDP-{alpha}-D-mannose pyrophosphorylase from Salmonella enterica, group B, for the synthesis of GDP-{alpha}-D-mannose from D-mannose. Glycobiology, 6, 591–597.[Abstract/Free Full Text]

Ge,Z., Chan,N.W., Palcic,M.M. and Taylor,D.E. (1997) Cloning and heterologous expression of an {alpha}-1,3-fucosyltransferase gene from the gastric pathogen Helicobacter pylori. J. Biol. Chem., 272, 21357–21363.[Abstract/Free Full Text]

Gokhale,U., Hindsgaul,O. and Palcic,M.M. (1990) Chemical synthesis of GDP-fucose analogs and their utilization by the Lewis {alpha}-(1->4) fucosyltransferase. Can. J. Chem., 68, 1063–1071.

Guo,Z. and Wang,P.G. (1997) Utilization of glycosyltransferases to change oligosaccharide structures. App. Biochem. Biotech., 68, 1–20.

Hanahan,D. (1983) Studies on transformation of Escherichia coli plasmids. J. Mol. Biol., 127, 100–104.

Hokke,C.H., Neeleman,A.P., Koeleman,C.A.M. and van den Eijnden,D.H. (1998) Identification of an alpha3-fucosyltransferase and a novel alpha2-fucosyltransferase activity in cercariae of the schistosome Trichobilharzia ocellata:biosynthesis of the Fuc{alpha}1->2Fuc{alpha}1->3[Gal (NAc)ß1->4]GlcNAc sequence. Glycobiology, 8, 393–406.[Abstract/Free Full Text]

Kornfeld,R.H. and Ginsburg,V. (1966) Control of synthesis of guanosine 5'-diphosphate D-mannose and guanosine 5'-diphosphate L-fucose in bacteria. Biochim. Biophys. Acta, 117, 79–87.[Medline]

Laemmli,U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 277, 680–685.

Le Grice,S.F. and Grueninger-Leitch,F. (1990) Rapid purification of homodimer and heterodimer HIV-1 reverse transcriptase by metal chelate affinity chromatography. Eur. J. Biochem., 187, 307–314.[Web of Science][Medline]

Liu,H.-W. and Thorson,J.S. (1994) Pathways and mechanisms in the biogenesis of novel deoxysugars by bacteria. Annu. Rev. Microbiol., 48, 223–256.[Web of Science][Medline]

Miller,J.H. (1972) Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

Nimtz,M., Grabenhorst,E., Gambert,U., Casta,J., Wray,V., Morr,M., Thiem,J. and Conrath,H.S. (1998) In vitro {alpha}1–3 or {alpha}1–4 fucosylation of type I and II oligosaccharides with secreted forms of recombinant human fucosyltransferases III and VI. Glycoconj. J., 15, 873–883.

Okazaki,R., Okazaki,T., Strominger,J.T. and Michelson,A.M. (1962) Thymidine diphosphate 4-keto-6-deoxy-D-glucose, an intermediate in thymidine diphosphate L-rhamnose synthesis in Escherichia coli strains. J. Biol. Chem., 237, 3014–3026.[Free Full Text]

Payne,S.H. and Ames,B.N. (1982) A procedure for rapid extraction and high-pressure liquid chromatographic separation of the nucleotides and other small molecules from bacterial cells. Anal. Biochem., 123, 151–161.[Web of Science][Medline]

Piepersberg,W. (1994) Pathway engineering in secondary metabolite-producing actinomycetes. Crit. Rev. Biotechnol., 14, 251–285.[Web of Science][Medline]

Piepersberg,W. and Distler,J. (1997) Aminoglycosides and sugar components in other secondary metabolites. In Rehm,H.-J., Reed,G., Pühler,A. and Stadler,P. (eds.), Biotechnology, 2nd ed., Vol. 7. VCH-Verlagsgesellschaft, Weinheim, pp. 397–488.

Rizzi,M., Tonetti,M., Vigevani,P., Sturla,L., Bisso,A., Flora,A.D., Bordo,D. and Bolognesi,M. (1998) GDP-4-keto-6-deoxy-D-mannose epimerase/reductase from Escherichia coli, a key enzyme in the biosynthesis of GDP-L-fucose, displays the structural characteristics of the RED protein homology superfamily. Structure, 15, 1453–1465.

Sambrook,J., Fritsch,E.F. and Maniatias,T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

Sanger,F., Nicklen,S. and Coulson,A.R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA, 74, 5463–5467.[Abstract/Free Full Text]

Schmidt,R.R., Wegmann,B. and Jung,K.H. (1991) Stereospecific synthesis of {alpha}- and ß-L-fucopyranosyl phosphates and of GDP-fucose via trichloroacetimidate. Liebigs Ann. Chem., 121–124.

Schmitt,J., Hess,H. and Stunneberg,H.G. (1993) Affinity purification of histidine-tagged proteins. Mol. Biol. Rep., 18, 223–230.[Web of Science][Medline]

Stevenson,G., Hobbs,M., Andrianopoulos,K. and Reeves,P.R. (1996) Organization of the Escherichia coli K-12 gene cluster responsible for production of the extracellular polysaccharide colanic acid. J. Bacteriol., 178, 4885–4893.[Abstract/Free Full Text]

Tonetti,M., Sturla,L., Bisso,A., Benatti,U. and De Flora,A. (1996) Synthesis of GDP-L-fucose by the human FX protein. J. Biol. Chem., 271, 27274–27279.[Abstract/Free Full Text]

Sturla,L., Bisso,A., Zanaridi,D., Benatti,U., De Flora,A. and Tonetti,M. (1997) Expression, purification and characterization of GDP-D-mannose 4,6-dehydratase from Escherichia coli. FEBS Lett., 412, 126–130.[Web of Science][Medline]

Wilson,K. (1988) Current Protocols in Molecular Biology. Greene Publishing Associates and Wiley Interscience, New York.

Zhang,L., Toivanen,P. and Skurnik,M. (1996) The gene cluster directing O-antigen biosynthesis in Yersinia enterocolitica serotype 0:8: identification of the genes for mannose and galactose biosynthesis and the gene for the O-antigen polymerase. Microbiology, 142, 277–288.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
C. Qin, W. Qian, W. Wang, Y. Wu, C. Yu, X. Jiang, D. Wang, and P. Wu
GDP-mannose pyrophosphorylase is a genetic determinant of ammonium sensitivity in Arabidopsis thaliana
PNAS, November 25, 2008; 105(47): 18308 - 18313.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Kotake, S. Hojo, N. Tajima, K. Matsuoka, T. Koyama, and Y. Tsumuraya
A Bifunctional Enzyme with L-Fucokinase and GDP-L-fucose Pyrophosphorylase Activities Salvages Free L-Fucose in Arabidopsis
J. Biol. Chem., March 28, 2008; 283(13): 8125 - 8135.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
T. T. T. Thuy, K. Liou, T.-j. Oh, D. H. Kim, D. H. Nam, J. C. Yoo, and J. K. Sohng
Biosynthesis of dTDP-6-deoxy-{beta}-D-allose, biochemical characterization of dTDP-4-keto-6-deoxyglucose reductase (GerKI) from Streptomyces sp. KCTC 0041BP
Glycobiology, February 1, 2007; 17(2): 119 - 126.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
M. Maki and R. Renkonen
Biosynthesis of 6-deoxyhexose glycans in bacteria
Glycobiology, March 1, 2004; 14(3): 1R - 15R.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
D. J. Becker and J. B. Lowe
Fucose: biosynthesis and biological function in mammals
Glycobiology, July 1, 2003; 13(7): 41R - 53R.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
C. Albermann and W. Piepersberg
Expression and identification of the RfbE protein from Vibrio cholerae O1 and its use for the enzymatic synthesis of GDP-D-perosamine
Glycobiology, August 1, 2001; 11(8): 655 - 661.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Kneidinger, M. Graninger, G. Adam, M. Puchberger, P. Kosma, S. Zayni, and P. Messner
Identification of Two GDP-6-deoxy-D-lyxo-4-hexulose Reductases Synthesizing GDP-D-rhamnose in Aneurinibacillus thermoaerophilus L420-91T
J. Biol. Chem., February 16, 2001; 276(8): 5577 - 5583.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (21)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Albermann, C.
Right arrow Articles by Piepersberg, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Albermann, C.
Right arrow Articles by Piepersberg, W.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?