Glycobiology, 2000, Vol. 10, No. 8 789-802
© 2000 Oxford University Press
FUT4 and FUT9 genes are expressed early in human embryogenesis
U 504 INSERM, Université de Paris Sud XI, 94807 Villejuif, France, 2UMR 1599 CNRS, Cytogénétique, IGR, 94805 Villejuif, France, and 3Hôpital de Pontoise, 95300 Pontoise, France
Received on November 29, 1999; revised on February 1, 2000; accepted on February 12, 2000.
| Abstract |
|---|
|
|
|---|
The Lex oligosaccharide is expressed in organ buds progressing in mesenchyma, during human embryogenesis. Myeloid-like
3-fucosyltransferases are good candidates to synthesize this oligosaccharide. We investigated by Northern analysis all the
3-fucosyltransferase gene transcripts and only FUT4 and FUT9 were detected. The enzymes encoded by the FUT4 and FUT9 genes are the first
3-fucosyltransferases strongly expressed during the first two months of embryogenesis. The Northern profile of expression of the embryo FUT4 transcripts is similar in size and sequence to the known FUT4 transcripts of 6 kb, 3 kb, and 2.3 kb, but a new FUT9 transcript of 2501 bp, different from the known mouse (2170 bp) and human (3019 bp) transcripts was cloned. FUT3, FUT5, FUT6, and FUT7 were not detected by Northern blot. The FUT3 and FUT6 transcripts start to appear at this stage, but are only detected by reverse transcriptase-PCR analysis. The expression of FUT5 is weaker than FUT3 and FUT6 and the RT-PCR signal is faint and irregular. FUT7 is not detected at all. Using mRNA from 40- to 65-day-old embryos, we have prepared different hexamer and oligo-dT cDNA libraries and cloned, by rapid amplification cDNA ends-PCR, FUT4 and FUT9
3-fucosyltransferase transcripts. The tissue expression of the embryonic FUT9 transcript is closer to that observed for the mouse (brain), than to the known human (stomach) transcripts. The acceptor specificity and the kinetics of the
3-fucosyltransferase encoded by this FUT9 transcript are similar to the FUT4 enzyme, except for the utilization of the lac-di-NAc acceptor which is not efficiently transformed by the FUT9 enzyme. Like FUT4, this embryonic FUT9 is N-ethylmaleimide and heat resistant and the corresponding gene was confirmed to be localized in the chromosome band 6q16. Finally, this FUT9 transcript has a single expressed exon as has been observed for most of the other vertebrate
2- and
3-fucosyltransferases. Key words: CD15/chromosome location/embryo-fetal development/fucosyltransferase/Lewis x
| Introduction |
|---|
|
|
|---|
The Lewis x carbohydrate structure (X, CD15 or SSEA-1) belongs to the human Lewis blood group-related antigens and is found as a terminal glycotope in O and N-linked glycoproteins and in glycolipids. It is widely distributed in many tissues such as gastrointestinal tract (Mollicone et al., 1985
We have previously shown, a differential expression of three categories of
3-fucosyltransferase activities able to synthesize the Lex antigen in different organs. The three groups of enzymes had different transfer profiles when examined using synthetic oligosaccharide acceptors. We called these activity profiles myeloid, plasma, or Lewis (Mollicone et al., 1990
). The myeloid-like
3-fucosyltransferase activity is mainly found in leukocytes and is characterized by the use of type-2 N-acetyllactosamine (Galß1,4GlcNAc) and H-type-2 (Fuc
1,2Galß1,4GlcNAc) acceptors to make Lex or Ley antigens, respectively. The plasma-like
3-fucosyltransferase activity is mainly found in adult plasma and liver and is able to use in addition, sialyl-type-2 N-acetyllactosamine (NeuAc
2,3Galß1,4GlcNAc) to make either of Lex, Ley, or sialyl-Lex. The Lewis-like
3-fucosyltransferase activity is mainly found in adult exocrine secretions and is able to use, in addition, type-1 acceptors such as type-1 N-acetyllactosamine (Galß1,3GlcNAc), H-type-1 (Fuc
1,2Galß1,3GlcNAc), and sialyl-type-1 N-acetyllactosamine (NeuAc
2,3Galß1,3GlcNAc), with higher efficiency than the type-2 acceptors, in order to make, respectively, Lea, Leb, or sialyl-Lea.
Six human genes encoding
3/4-fucosyltransferases have been cloned and registered in the Genome Data Base (GDB) as FUT3 (Kukowska-Latallo et al., 1990
), FUT4 (Goelz et al., 1990
; Lowe et al., 1991
), FUT5 (Weston et al., 1992a
), FUT6 (Weston et al., 1992a
), FUT7 (Natsuka et al., 1994
; Sasaki et al., 1994
), and FUT9 (Kaneko et al., 1999a
). We have previously assigned FUT4 to 11q21 (Reguigne et al., 1994
), the cluster FUT6-FUT3-FUT5 to 19p13.3 (Reguigne-Arnould et al., 1995
) and FUT7 to 9q34.3 (Reguigne-Arnould et al., 1996
).
During the early embryonic stage (before eight weeks of gestation) we only detected a myeloid-like
3-fucosyltransferase activity in all the organs tested. Then, in each organ, we demonstrated a switch from this myeloid-like activity pattern to adult forms of
3-fucosyltransferases, as a function of the maturation of the organ. In each organ we observed a concomitant decrease of the myeloid-like activity and the appearance of plasma- and/or Lewis-like activities after the 10th week of development (Mollicone et al., 1992
). In the early embryonic period the main oligosaccharide epitopes expressed are precursors of ABH and Lewis antigens, Lex is preferentially found on proliferating cells in areas showing progression of organ buds in mesenchyma (Candelier et al., 1993
).
In order to elucidate the genes encoding the enzymes with myeloid activity responsible for the stage-specific expression of Lex on embryonic cells, we examined, by Northern blot and reverse-transcriptase-PCR (RT-PCR), the expression of
3-fucosyltransferase transcripts (FUT3, FUT4, FUT5, FUT6, FUT7, and FUT9) during the first 2 months of human development. We made different cDNA libraries using human mRNA from 40- to 65-day-old embryos and we cloned a new FUT9 transcript by rapid amplification cDNA ends-PCR (RACE-PCR), and confirmed the gene localization on the chromosome band 6q16.
The sequence of the FUT9 human cDNA described in this article has been submitted to GenBank/EBI with the accession number AJ238701.
| Results |
|---|
|
|
|---|
-3/4-Fucosyltransferases detected during the first 2 months of human developmentWe detected transcripts hybridizing with the FUT4 and FUT9 specific cds probes by Northern blot with poly-A+ RNA from entire 40- to 70-day-old embryos. For FUT4, the transcript profile observed was similar to the one described with the HL60 cell line. One or two transcripts were detected at about 6 kb and two others at 3 and 2.3 kb. The 3 kb transcript was more abundant in embryos, whereas the 2.3 kb transcript was more abundant in HL60 cells (Weston et al., 1999
|
The tissue distribution of FUT4 and FUT9 transcripts, was studied with commercial Northern blots (Invitrogen) containing fetal and adult tissue mRNAs. During the fetal period, the eight tissues tested (heart, kidney, skin, small intestine, brain, liver, lung, and muscle) expressed the FUT4 transcripts, but with different profiles and intensities (Figure 2). The FUT4 transcripts are abundant in liver, muscle, kidney, skin, and small intestine. They are moderately expressed in brain, lung, and heart. In all these tissues, except in small intestine, the FUT4 transcripts of 3 kb and 6 kb are detected, but the 6 kb band is stronger, except in the skin where both transcripts are expressed at the same level. In liver and small intestine, the transcript profile is slightly different. In liver, the 6 kb band of FUT4 is strong and the two transcripts at 3 kb and 2.3 kb are weak. In small intestine the 6 kb and the 2.3 kb transcripts are both strongly expressed.
|
The adult counterparts of these positive fetal tissues express differently these transcripts of FUT4. For each tissue, the adult and the fetal profiles are qualitatively similar, but have some quantitative expression differences. Large amounts of FUT4 transcripts are found in lung and small intestine. Only very low amounts are found in kidney, liver, and brain, and no FUT4 transcript at all is detected in muscle (Figure 3). Other adult tissues were also tested for the expression of FUT4: spleen, uterus, urinary bladder, pancreas, placenta, stomach, ileum, jejunum, colon, and rectum. Transcripts of 6 kb and 2.3 kb remain abundant in the digestive tract, with stronger expression of the 2.3 kb mRNA. A cranio-caudal decrease of the expression of FUT4 in the small and large intestines is observed (in jejunum FUT4 is more expressed than in ileum; a similar quantitative decrease is observed between colon and rectum). The stomach shows the same transcript profile, albeit more weakly. The three FUT4 transcripts are detected in placenta with a stronger expression of the 6 kb messenger. Only the 6 kb band is expressed in pancreas, whereas moderate expression of the 6 kb and the 3 kb transcripts is observed in lung and urinary bladder. A low expression of the same profile is found in spleen, brain, heart, kidney, and uterus. In general FUT4 transcripts were less expressed in adult as compared to fetal tissues, with the exception of intestine, lung, and pancreas where these transcripts are moderately expressed in the adult.
|
The tissue distribution of the two FUT9 transcripts (about 12 kb and 2 kb) is shown on the same Northern blots (Figures 2 and 3). The expression of the 2 kb transcript is ubiquitous and stronger in fetal tissues, while the 12 kb transcript is restricted to brain, kidney, placenta, and pancreas. In muscle, an exposure of 10 days of the film shows that the 12 kb transcript is faintly detected in fetus and disappears completely in the adult. In kidney the expression is moderate in both fetal and adult stages, but in brain, this transcript is strongly expressed in the fetus and decreases in the adult.
Reverse transcriptase polymerase chain reaction (RT-PCR)
Three types of mRNA matrix were reverse transcribed with oligo-dT or random primers and used for RT-PCR analyses: (1) a mixture of poly-A+ corresponding to a pool of 10 embryos (cDNA libraries) of 4065 days old; (2) poly-A+ from isolated 38 d, 50 d, and 60 d embryos treated and transcribed as described in Materials and methods; (3) or a pool of Marathon-Ready cDNA reversed transcribed by Clontech, from human poly-A+ mRNA of 8-week-old embryos.
Using distinct sets of specific primers (hF4-U and hF4-L; hF4-8151s and hF4-8150as; hF9-s and hF9-as; see Table I), FUT4 and FUT9 transcripts are reproducibly amplified at this stage of development, in all the cDNA tested.
|
For the amplification of FUT3, FUT5 and FUT6 genes, we used several sets of specific primers already described (Weston et al., 1992a
Taken together, Northern blots and RT-PCR results illustrate that FUT4 and FUT9 are the earliest transcripts of
3-fucosyltransferase expressed in human embryos and tend to decrease in the majority of adult tissues. During the embryonic period FUT3, FUT6, and FUT5 start to appear, but are only detected by PCR. FUT7 is not yet expressed.
Identification of the 5' and 3' cDNA ends of the embryonic FUT9 transcript
To verify the presence of the FUT9 cDNA in our libraries, we first cloned a fragment of the human embryonic FUT9 transcript with mouse primers (Table I) (Kudo et al., 1998
). Then we used this human sequence to design the specific RACE-PCR primers, required to amplify the 5' and 3' cDNA ends of this embryonic FUT9 transcript.
We performed a RACE-PCR to isolate the 5' end of the FUT9 cDNA. A first PCR, using the cDNA-plasmids of the different libraries as templates, was done with the primers: hF9-2as and pCDM8-2118s or hF9-2as and pCDM8-2659as. Then a nested 5' RACE-PCR was performed using the internal primers: hF9-365as and pCDM8-2202s or hF9-365as and pCDM8-2604as (Table I). Several repetitive PCRs on the three cDNA libraries with the above combinations of primers, always gave the same unique PCR product of 466 bp. After gel purification the fragment was integrated in pCR3.1, and 10 clones were selected by sequencing. One 5' end-RACE, error-free, and sense-orientated clone was chosen to construct the entire FUT9 cDNA transcript of 2501 bp (Figure 4).
|
To isolate the 3' end of FUT9, we used the embryonic oligo-dT transcribed cDNA library. One PCR, with either of the sets of primers: hF9-1s and pCDM8-2118s or hF9-1s and pCDM8-2659as, was enough to amplify a fragment of 2185 bp. After its integration in pCR3.1 and sequencing selection of a well orientated clone (Figure 4), we used this 3' RACE clone to construct the final FUT9 complete cDNA clone of 2501 bp. The two selected 5' RACE and 3' RACE clones were digested with the RsrII endonuclease, in their overlapping portion (position 285). This enzyme cuts in addition in pCR3.1 at position 2502 (3' side of the polylinker, Invitrogen map). After gel purification we ligated the error free 5' RACE side of FUT9 (first 389 bp from one of the selected clones) with the error-free 3' RACE side (from the other clone) to obtain the final construct of 2501 bp. After subcloning, a PCR selection on colonies with the primers hF9-105s and hF9-1260as allowed us to select two clones with an insert of 2501 bp, whose sequence was verified on the portions encompassing the RsrII sites.
Characteristics of the embryonic FUT9 cDNA transcript
This FUT9 cDNA transcript of 2501 bp (AJ238701) has a regular poly-A tail (A16), with eight RNA stabilization sites (ATTTA) and four polyadenylation sites (AATAAA) and is therefore different from the stomach transcript of 3019 bp (AB023021), which has not this poly-A tail (Kaneko et al., 1999b
). The first 8 positions of the 5' UT of the embryo FUT9 transcript are different from the equivalent positions of the stomach transcript. One position is different and four nucleotides are missing in the 3' UT region. However, the two transcripts encode the same protein, since only three punctual nucleotide differences, giving no change at the level of the protein sequence were found in the cds (T342
C, T354
A, T357
C). The tissue distribution observed with our transcript is similar to mouse (Kudo et al., 1998
), with regard to expression in brain and kidney. Our FUT9 transcript was not detected in stomach and this is at variance with the stomach localization described for the human adult FUT9 transcript (Kaneko et al., 1999a
), but this could be related to poor quality of the stomach RNA in the commercial blots used. Compared to the mouse 2170 bp cDNA, our transcript has 70% homology in the 5' UT portion, 92% homology in the cds and 55% homology with the mouse 3' UT side and the putative N-glycosylation site is at the same position. This gives an identity of 99% at the level of the two translated proteins, the 1% difference corresponds to the same three amino-acid substitutions described previously (Kaneko et al., 1999a
): mouse Val-37 to Ile; mouse Thr-237 to Ala and mouse Phe-292 to Tyr.
Identification of the 5' and 3' cDNA ends of the embryonic FUT4 transcripts
We first verified the presence of the FUT4 transcripts in our libraries using the internal specific primer combinations: hF4-8150as and hF4-8151s or hF4-69s and hF4-8150as (Table I), which give the 319 and 1055 bp fragments, respectively. They were cloned in pCR3.1 and sequenced. They correspond to the already described FUT4 gene (Lowe et al., 1991
). The same system of 3' RACE-PCR performed for FUT9 was performed for this gene, using FUT4 specific sets of primers (hF4-1050s for the first PCR and hF4-1206s for the second PCR) in association with the already described pCDM8 primers. Two fragments corresponding to the 2.3 kb (FUT4-short) and the 3 kb (FUT4-long) FUT4 cDNA poly-A tails were found (Goelz et al., 1990
). We never obtained sequences corresponding to the 6 kb transcripts seen by Northern blot. The FUT4 transcript is one of the genes, together with FUT7, having the largest proportion of GC in its sequence (more than 70% in the first 550 pb of the 5' region). These kind of sequences are difficult to reverse transcribe, because strong secondary structures are generated by the large proportion of GC. The FUT4 clone used in the following transfections and fucosyltransferase assays is similar to the 2.3 kb FUT4 transcript (Goelz et al., 1990
).
Expression of
3-fucosyltransferases in transfected COS7 cells
After 48 h, COS7 cells transfected with pCR3.1 alone or with pCR3.1-FUT9 or pCR3.1-FUT4 constructs were subjected to cell membrane immunofluorescence (Table II). Cells transfected with either of FUT9 or FUT4 constructs expressed Lex epitopes, but FUT4 gave consistently higher percentages of positive cells than FUT9. Both enzyme activities have a myeloid-like
3-fucosyltransferase activity profile, as reported for the orthologous mouse FUT9 sequence (Kudo et al., 1998
).
|
The comparative fucosyltransferase assays made with the other
3-fucosyltransferases, confirmed the tendencies observed by immunofluorescence, using type-1 and type-2 substrates. Table III summarizes the acceptor specificities of the
3/4-fucosyltransferases in COS7 cell homogenates transfected with FUT3, FUT4, FUT5, FUT6 (Costache et al., 1997
3-fucosyltransferases cds are listed in Table I). H-type-2 was the best acceptor for the majority of
3-fucosyltransferases except for FUT3 and FUT7. The incorporation of
L-(14C)-fucose onto the other acceptors is expressed as the percentage of the activity on H-type-2 for each enzyme. FUT7 has a peculiar activity profile, because there is only transfer on sialyl-type-2 N-acetyllactosamine and therefore the 100% value corresponds to this acceptor. Compared to the H-type-2 transfer, the type-2 N-acetyllactosamine is a good acceptor for the FUT6, FUT9, and FUT4 enzymes and a poor acceptor for the enzymes transferring
L-fucose onto type-1 structures (FUT5 and FUT3). We have tested a new acceptor, lac-di-NAc (GalNAcß1,4GlcNAcß-O-R), which is a good acceptor for FUT4 and a poor acceptor for FUT3 and FUT9. The sialyl-type-2 N-acetyllactosamine is a good acceptor for FUT6 and the unique acceptor for FUT7. This structure is a poor acceptor for FUT3 and FUT5, a very poor acceptor for FUT4 and accepts not at all for FUT9. The type-1 structures are good acceptors for FUT5 and the best substrates for FUT3. Lactose (Galß1,4Glcß-O-R) is only a poor acceptor for FUT3 and FUT5 and the type-4 precursor structure (Galß1,3GalNAcß-O-R) is not an acceptor for the
3-fucosyltransferases studied.
|
We tested comparatively the proportion of
3-fucosyltransferase activity associated with FUT4 and FUT9 transfected cells or in their respective culture supernatants. In FUT4 transfected cells, 70% of enzyme activity was associated with the cell pellet, whereas 30% was found in the supernatant. The same comparative measures on FUT9 transfected cells gave 100% of the activity associated with the cell fraction and no activity was detected in the supernatant.
Kinetic studies
Apparent Km were calculated for GDP-fucose (range of concentrations 1230 µM) from Lineweaver-Burk plots of initial rate data, obtained at 300 µM concentration for H-type-2 (FUT4, FUT6, FUT9) or H-type-1 (FUT3). The apparent affinities for GDP-fucose of the enzymes encoded by FUT9 and FUT4 (21 µM and 40 µM) were weaker than those encoded by FUT6 and FUT3 (6 µM and 12 µM; Table IV). The apparent affinities were also calculated for H-type-2 at saturation of GDP-fucose for all the enzymes. For FUT6 (plasma-like profile) the apparent Km for H-type-2 (17 µM) appeared stronger than those obtained for FUT4 and FUT9 enzymes (130 µM and 68 µM). The high Km value of 1330 µM for H-type-2 is expected for the FUT3 enzyme, because H-type-2 is not a good acceptor for FUT3, as compared to H-type-1. The Km for H-type-1 (40 µM) is more than 30-fold better. The values of Vmax for the different acceptors were similar for FUT9, FUT6 and FUT3 (H-type-2). The values of Vmax for FUT3 (GDP-fucose and H-type-1) are intermediate and the Vmax values of FUT4 are the best under our experimental conditions (Table IV).
|
N-Ethylmaleimide (NEM) inhibition
The
3-fucosyltransferase activity of homogenates from COS7 cells transfected with FUT3, FUT4, FUT6, and FUT9 constructs was determined in the presence of NEM at the optimum conditions for each enzyme. A range of concentrations 016 mM of NEM was added to the reaction mixtures and the enzyme activity was measured on H-type-2 (FUT4, FUT6 and FUT9) or H-type-1 (FUT3) after 1 h incubation at 37°C. For each enzyme we considered the rate of transfer of
L-(14C)-fucose without inhibitor as 100%. The activity expressed by the cells transfected with FUT4 and FUT9 constructs was resistant to the highest concentrations of inhibitor tested (16 mM) and for FUT9 a slight activation of about 20% is observed between 3 and 16 mM of NEM. The FUT6 homogenate, gives 50% inhibition at 2 mM and complete inhibition at 8 mM. The FUT3 homogenate looses 50% of Lewis activity at about 5 mM of inhibitor and 80% at 16 mM (Figure 5A). The FUT3 and FUT6 enzymes have a cysteine in position 143 responsible for the sensitivity to NEM, whereas this amino acid is replaced by a threonine in the equivalent position on FUT4 (Holmes et al., 1995). As expected, the FUT9 enzyme has also threonine in this position.
|
Heat inactivation
Prior to the
3-fucosyltransferase assay, homogenates from COS7 cells transfected with FUT4, FUT6, and FUT9 constructs were incubated at 50°C for different times, between 1 and 30 min. The residual enzyme activity was then measured at 37°C for 2 h. For FUT6, more than 50% of the fucosyltransferase activity was lost in 4 min, whereas FUT4 and FUT9 enzymes still had 80% of enzyme activity at 30 min (Figure 5B).
Chromosomal localization of the FUT9 gene
The presence of the FUT9 gene was tested by PCR on 53 genomic DNAs from human-rodent somatic hybrid cell lines. The correlation between the presence of each human individual chromosome, investigated by classical cytogenetic techniques (Nguyen van Cong et al., 1986
; Couillin et al., 1991
), and the FUT9-PCR product of 808 bp is shown in Table V. Twenty-three clones, of which 22 retained the chromosome 6, expressed the human-specific FUT9-PCR product. The remaining 30 somatic hybrid clones, negative by PCR, lacked the chromosome 6. Many positive and negative discrepancies were observed for all the other chromosomes including 9, 11, 14, and 19, where we have previously assigned the other members of the fucosyltransferase gene family (Reguigne-Arnould et al., 1996
; Costache et al., 1997
). These results support a chromosome 6 localization of the human FUT9 gene (Table V). The single discrepant clone (CH.BL1) can be explained by the high sensitivity of PCR. This clone may have retained the chromosome 6 in a low percentage of cells or only a chromosome fragment not detected by classical cytogenetic techniques.
|
The same primers used to amplify FUT9 on the genomic DNA of the hybrids, were used to screen the BAC (bacterial artificial chromosome) library of the CEPH (Centre dEtudes du Polymorphisme Humain, Paris, France). Two BACs having the FUT9 gene were selected: H330e11 and B601c3 and were used as FISH (fluorescence in situ hybridization) probes to identify the R band location of the FUT9 gene on chromosome 6. Twenty-five metaphases were observed for each BAC probe. As shown in Figure 6, bright hybridization signals were observed on the long arm of chromosome 6, without evidence of chimerism. The FISH procedure combined with Alu-PRINS (primed in situ labeling) (Coullin et al., 1999
|
The FUT9 transcript of 2.5 kb is mono-exonic
Genomic DNA from an adult individual and from the two FUT9 BACs were amplified, with several associations of primers (Table I). All the combinations gave the same results on the isolated cDNA clone of FUT9 and on the different genomic templates used (genomic DNA and BACs). The primers hF9-10s and hF9-1as gave the 343 bp fragment expected if the 5' UT side of the FUT9 gene is contiguous to the cds and included in the same exon. When we combine a primer starting on the ATG (hF9-105s) with an antisense primer (hF9-1260as), encompassing the position 1146 after the stop codon, we amplified a DNA fragment of 1150 bp, corresponding to the entire coding region of FUT9. Using the primers hF9-10s and hF9-133as we amplified all the 5'UT side of the gene, plus 30 bp after the ATG, giving a fragment of 133 bp and suggesting a single exon.
Southern blots with human genomic DNA restricted with EcoR1 were probed with three different regions of the FUT9 cDNA (Figure 4). As illustrated in this figure, the entire FUT9 cDNA of 2501 bp has three EcoR1 restriction sites at positions: 20, 1529, and 2221. The 5' UT probe of 133 bp revealed a single band at about 2.5 kb in the human genomic DNA restricted with EcoR1. The cds probe detected a single restriction DNA fragment of 1.5 kb, which is expected because this probe detects the fragment situated between the two restriction sites at positions 20 and 1529. When we hybridized with the 3' UT probe, the two expected bands of 1.5 kb and 0.7 kb were found, showing that the 3' end of the gene is contiguous to the cds and is included in the same DNA fragment (Figure 7). Other Southern blots (data not shown) were made with the same genomic DNA restricted with different enzymes or association of enzymes: BalI alone, BalI/EcoRI, EcoRI/HindIII, and BalI/HindIII. The DNA digested with BalI alone or double digested with BalI/EcoRI and probed with the 5' UT of FUT9, detected one band at about 1.5 kb with the BalI digestion and one reduced band of 1.3 kb with the BalI/EcoRI DNA. This difference in size corresponds to the distance between EcoRI and BalI sites, in the cDNA (Figure 4). The Southern blot containing the BalI/EcoRI, BalI/HindIII, and EcoRI/HindIII DNA restrictions was probed with the cds of FUT9, and in each type of restriction profile we detected one fragment with the expected size. A reduced band of 1.3 kb is found on the BalI/EcoRI digest, a reduced band of 1.1 kb for the BalI/HindIII digest and finally a band of 1.35 kb for the EcoRI/HindIII sample. All these bands have the expected sizes if the restriction site positions in a single DNA exon are considered (Figure 4).
|
In conclusion, the results obtained with either PCR or Southern blot, show that the entire FUT9 cDNA described in this paper is included in a single exon as already reported for the coding regions of the great majority of vertebrate
2- and
3-fucosyltransferase genes. | Discussion |
|---|
|
|
|---|
We described previously (Mollicone et al., 1992
3-fucosyltransferase ubiquitously expressed in all organs of embryos of less than 8 weeks and, after this embryonic period, we observed a switch from this early activity to adult forms of
3/4-fucosyltransferases. We suggested that the FUT4 gene was a candidate to encode this enzyme activity, responsible for the synthesis of Lex on the surface of the proliferating cells, in areas showing progression of organ buds in mesenchyma (Candelier et al., 1993
We have now identified two
3-fucosyltransferase genes susceptible to control the biosynthesis of the Lex antigen during the embryonic stage of human development. FUT4 and FUT9 are the earliest
3-fucosyltransferase genes strongly expressed during the first two months of human embryo-fetal development. At this stage the transcripts of FUT6 and FUT3 genes are weakly expressed, FUT5 was only irregularly and faintly amplified and the FUT7 transcript was not detected at all. These results are in good agreement with our previous data (Mollicone et al., 1992
), since both FUT4 and FUT9 genes encode for
3-fucosyltransferases with a myeloid-like activity profile, mainly able to synthesize the Lex antigen on the type-2 N-acetyllactosamine precursor and the Ley on the H-type-2 structure. Other enzymes with this activity profile are expected in human adult brain, since a myeloid-like
3-fucosyltransferase activity resistant to Co++ was described in this tissue (Mollicone et al., 1992
). We have confirmed this finding in adult and 7-week-old brain, but neither of the 5- or 6-week-old brain samples or any of the cloned variants of FUT4 or FUT9 enzymes kept its enzymatic activity in the presence of Co++.
We detected by Northern blot two transcripts of FUT9: one around 2 kb ubiquitously expressed in tissues from embryonic and fetal stages with a decrease of expression in the adult and the other of about 12 kb with tissue specific distribution, which is expressed strongly in brain, moderately in kidney and weakly in muscle in the fetal period. In the adult it is expressed in pancreas, placenta, and kidney; decreases in brain; disappears from muscle; and was not detected in any of the other tissues tested. The existence of different size transcripts with differential tissue expression, suggests that each transcript may have particular regulatory sequences contributing to the tissue specificity of enzyme expression, as already suggested for the different transcripts observed in FUT3, FUT5, and FUT6 (Cameron et al., 1995
).
We have cloned an embryonic FUT9 cDNA of 2.5 kb and located the gene in 6q16. Its tissue expression is similar to the mouse FUT9, with regard to the expression in kidney and brain (Kudo et al., 1998
). With regard to the utilization of the H-type-2 and type-2-N-acetyllactosamine acceptors, the FUT9 enzyme has a substrate specificity pattern similar to FUT4. But, in contrast to FUT4, this FUT9 enzyme does not transfer efficiently onto the lac-di-NAc substrate. In presence of MnCl2 there is no transfer on to lac-di-NAc for FUT9 and therefore, this acceptor can be used with MnCl2 to follow the FUT4 activity in tissues. In fact, our previous enzymatic results (Mollicone et al., 1992
), showing a myeloid-like activity pattern in all tissues before 8 weeks, were obtained in presence of 20 mM of MnCl2 and at the optimum pH for FUT4. Therefore, they mainly reflected the expression profile of the FUT4 enzyme, since the FUT9 activity is partially inhibited under these conditions.
During embryo-fetal development there is an early derepression of monomorphic genes such as FUT4 and FUT9, which are the oldest genes of the
3-fucosyltransferase family (Dupuy et al., 1999
) and encode myeloid-like
3-fucosyltransferases. Then, a late expression of adult polymorphic genes as FUT3, FUT6, and FUT7 (Bengston et al., 1999
), which have a specific tissue distribution in the adult (Mollicone et al., 1990
; Cameron et al., 1995
), is observed.
In evolution, FUT8 is the oldest of the family of
6- and
2-fucosyltransferase genes (Costache et al., 1997
; Oriol et al., 1999
) and FUT9 is the oldest of the
3-fucosyltransferase gene family (Kaneko et al., 1999a
). It is interesting that they both seem to be the more conserved fucosyltransferases, since between mouse and human proteins there is only 1% difference for FUT9 and only 5% difference for FUT8, while more than 20% difference is found for FUT4 (Gersten et al., 1995
) and FUT7 (Smith et al., 1996
) between mouse and human proteins. The nucleotide sequences of FUT8 and FUT9 genes have in addition, a high proportion of AT in their cds (the AT/GC ratios are 1.4 for FUT9, 1.2 for FUT8, and ~0.6 for the other types of vertebrate fucosyltransferase genes).
The functional significance of the Lex antigen expressed on the proliferating cells in areas showing progression of organ buds in mesenchyma, is not known yet. We hypothesize that the Lex carbohydrate could be involved in induction mechanisms permitting the mesenchyme to stimulate the organ buds to grow and branch. The Lex could be involved as receptor or ligand in signal transduction pathways, promoting cellular proliferation, since sialyl-Lex has been demonstrated to be a signal transduction molecule for leukocyteplatelet or leukocyteendothelial cell interactions (Wadel et al., 1995
).
In lower animal species such as zebrafish, two
3-fucosyltransferase genes zFT1 and zFT2, orthologous homologous of human FUT9, are transiently expressed during embryogenesis (Kageyama et al., 1999
). These two transcripts are separately transcribed before and after hatching, respectively, and they may play distinct roles in zebrafish embryo development. In mouse embryos an
3-fucosyltransferase gene orthologous to the human FUT4 gene is expressed during the first divisions of the embryo (Liu et al., 1999
). A recent work has shown that the presence, in mouse eggs, of an
3-fucosyl residue on structures as Lex or
Gal-Lex, appears to be necessary to bind sperm with high affinity (Johnston et al., 1998
).
In conclusion, the presence of Lex synthesized by early expressed myeloid-like
3-fucosyltransferases may be important in cellcell interactions during embryogenesis.
| Materials and methods |
|---|
|
|
|---|
Human embryos
Embryos aged from 38 to 70 days were obtained from legal abortions (the guidelines of the French National Committee of Ethics were followed) and were kept in PBS-DEPC buffer and tested for HIV and B hepatitis viruses, prior to being frozen in liquid nitrogen vapor and stored at 80°C, until required for RNA extraction.
RNA isolation and Northern blot analysis
Total RNA was extracted from 10 whole embryos with guanidine isothiocyanate and purified by cesium chloride gradient centrifugation. Embryonic poly-A+ mRNA were double purified using oligo(dT)-cellulose (sigma Type-3 oligo-dT cellulose) chromatography. Poly-A+ RNA (4 µg/lane) from embryos 4070 d old were denatured and fractionated with 1.2% formaldehyde agarose gel electrophoresis and transferred to Hybond-N membranes (Amersham-Pharmacia-Biotec). After transfer and immobilization on the membrane, the blots were hybridized for 16 h at 42°C, under the same conditions as the Southern blots, with 250 µg/ml denatured salmon sperm DNA and 10% dextran sulfate, with the cds-FUT9 probe (Figure 4), the cds-FUT4 probe, the cds-FUT5 probe, and the cds-FUT7 probe. The blots were first washed at low stringency: 3 x 5 min in (2x SSC, 0.1%SDS) at room temperature, followed by one 15 min (2x SSC, 0.1% SDS) wash at 50°C and autoradiographed. A last wash at high stringency was then performed (15 min at 65°C in 0.1x SSC, 0.1% SDS) and a new autoradiography was made. The tissue distribution of FUT4 and FUT9 transcripts was studied on fetal and adult tissues with commercial mRNA blots from Invitrogen, mRNA REALTM Blots (mRNA, Equal Amounts Loaded).
Construction of human embryo cDNA libraries
A mixture of 6 µg poly-A+ mRNA covering a range of ages of 40 to 65 d were reversed transcribed using either oligo-dT or random hexamer primers included in the Amersham kit "cDNA Synthesis System Plus" (RPN-1256Y) and complementary DNAs were synthesized according to the manufacturers recommendations. Hexamer or oligo-dT cDNAs libraries were constructed by inserting size fractionated double strand cDNAs (more than 1 kb) into the expression vector pCDM8, using BstXI adaptors. We obtained about 1.3 x 106 and 6 x 106 independent clones in the hexamer and oligo-dT cDNAs libraries, respectively. A maxi-preparation of the plasmids from each type of library was made and 200 ng of these plasmid cDNAs were used as templates for 5' and 3' RACE-PCR to clone human embryonic FUT4 and FUT9 transcripts. These libraries were also used as DNA templates for RT-PCR.
RT-PCR analysis
Poly-A+ RNAs (1 µg) from single human embryos (38 d, 50 d, or 60 d), were reverse transcribed at 42°C using oligo-dT or random hexamer primers to initiate first strand cDNA synthesis. Two transcriptases were used (1) Marathon cDNA amplification kit from Clontech with the MMLV-RT (Moloney Murine Leukemia VirusReverse Transcriptase), or (2) SUPERSCRIPT-II RT system from Life Technologies Inc. Contaminating DNA was removed from the poly-A+ RNAs by digestion with RNAse-free DNAseI (10 U/µg of RNA from Boehringer Mannheim for 15 min at room temperature, followed by 15 min at 70°C) and poly-A+ were purified by phenol/chloroform extraction.
The PCR reactions were carried out with primers specific for FUT3, FUT4, FUT5, FUT6, FUT7, and FUT9 genes (Table I), the KlenTaq mixture and 1 µl of cDNA templates diluted 1:50 for the first PCR and 1 µl of the first PCR product diluted 1:10 for the second PCR. The same PCR program described for RACE (see below) with the Advantage cDNA amplification mix (Clontech) was used.
cDNA cloning of FUT4 and FUT9 transcripts using 5' and 3' RACE-PCR
All PCRs were performed in 50 µl KlenTaq buffer containing 0.2 µM of each primer, 1 unit of KlenTaq DNA Polymerase (Clontech) and 0.2 mM dNTP with the touchdown-RACE program: initial denaturation 94°C 90 s, followed by 5 cycles of 94°C 30 s and 72°C 4 min, 5 cycles 94°C 30 s and 70°C 4 min, and 25 cycles 94°C 30 s and 68°C 4 min. For 5' and 3' RACE analysis 200 ng of plasmids from the libraries were used as template in the first PCR amplification. Because of the bi-directional orientation of the cDNA inserts in the pCDM8, we used in the first PCR a specific cds gene primer in association with primers designed in the 5' pCDM8-2118s and 3' pCDM8-2659as regions flanking the polylinker. The nested PCR was performed with nested gene specific primers in combination with 5' pCDM8-2202s and 3' pCDM8-2604as vector primers.
FUT9
The first PCR for the 5' and the 3' RACE was performed with the reverse cds specific primer hF9-2as or the sense cds specific primer hF9-1s, in association with the primers hybridizing in the vector: 5' pCDM8-2118s or the 3' pCDM8-2659as. For the nested PCR, we used as template 1 µl of the first 10 times diluted 5' and 3' RACE-PCR reactions and the nested reverse hF9-365as or sense hF9-2s specific cds primers, with the nested vector primers: 5' pCDM8-2202s or 3' pCDM8-2604as.
FUT4
Following the same scheme we used the same pCDM8 primers for the amplification of the FUT4 transcripts. For the 5' RACE, hF4-614as (first PCR) and hF4-473as (nested PCR). For the 3' RACE, hF4-1050s (first PCR) and hF4-1206s (nested PCR).
DNA sequencing
All the RACE-PCR products were cloned into the expression vector PCR3.1 (Eukaryotic TA Cloning Kit from Invitrogen) and sequenced in both directions by the dideoxy chain termination method with the T7 DNA Polymerase (Kit Amersham-Pharmacia-Biotech) and the adapted primers. At least 10 clones were sequenced for each RACE-PCR product.
Southern blot analysis
Triplicates of EcoRI, duplicates of BalI/EcoRI, EcoRI/HindIII, and BalI/HindIII and one BalI digested genomic DNA samples (10 µg/lane) were run in 0.8% agarose electrophoresis for 14 h at 1.25 V/cm in 0.5X TBE. After denaturation and neutralization of the gel, the samples were transferred on Hybond-N membrane (Amersham-Pharmacia-Biotech), in 20x SSC for 48 h. The DNA on the filter was immobilized by baking at 80°C for 2 h. Prehybridization and hybridization were performed for 16 h at 42°C in a buffer containing 50% formamide, 5x SSC, 1x PE, 150 µg/ml denatured salmon sperm DNA, and 5% dextran sulfate. Each blot containing digested DNA with EcoRI, was hybridized with three probes: (1) 5' UT cDNA-FUT9 probe; (2) the cds-FUT9 probe; (3) and the 3' UT cDNA-FUT9 (Figure 4). BalI and BalI/EcoRI digests were hybridized with the 5'UT probe and all the double digested samples were tested with the cds probe. After hybridization with the different probes, all the blots were washed three times for 5 min in 2x SSC, 0.1% SDS at room temperature, followed by one 15 min (2x SSC, 0.1% SDS) wash at 50°C. At this step, the blot with the 5'UT FUT9-probe was autoradiographed for 48 h. The other blots were subjected to a final wash of 10 min at 65°C in (0.1x SSC, 0.1% SDS) and autoradiographed.
Cell membrane indirect immunofluorescence staining
COS7 cells were transfected by the DEAE-dextran method (Davis et al., 1986
) with the
3-fucosyltransferase cDNA integrated in PCR3.1. After 48 h (Costache et al., 1997
), the carbohydrate: Lex, sialyl-Lex, Lea, sialyl-Lea, Cdw65 or Vim2, FH6 (sialyl-di-Lex) and B blood group related glycotopes were detected using monoclonal antibodies: 80H5, 82H5 and VIM2 from Immunotech-Coulter company; C-7798 from Sigma; KM93 from Kamiya Biomedical Co.; 7LE and CA-19.9 were gifts from J.Bara (INSERM U 482, Paris, France); FH6 was a gift from H.Clausen (Royal Dental School, Copenhagen, Denmark) and 9W4 was characterized at the II International Workshop on Antibodies against Blood group antigens, Lund, Sweden 1990. The secondary antibodies were fluorescein (FITC)-labeled sheep anti-mouse Ig (H + L) (Pasteur Diagnostics, Marne-la-Coquette, France). Stained cells were mounted under cover slides for observation with an epifluorescence microscope and positive (bright green) cells were counted.
3-Fucosyltransferase assays
Transfected cells were homogenized on ice in 1% Triton X-100 and the concentration of protein was measured by the BCA Protein Assay Reagent Kit, from Pierce. Each enzyme assay in a volume of 35 µl, contained 12.5 µg of the cell protein homogenate, 25 mM Cacodylate buffer pH 6.5 (FUT3, FUT5, FUT6 and FUT9) or 25 mM Tris/HCl pH 7.4 (FUT4), 4 mM ATP, without MnCl2 (FUT9) or 20 mM of MnCl2 (all other
3-fucosyltransferases), 10 mM of L-fucose, 4 µM GDP-(14C)-fucose (300 mCi/mmol, Amersham-Pharmacia-Biotech) and 5 µl of a 1 mg/ml solution of synthetic acceptors with the 8-methoxycarbonyloctyl aglycone (Alberta Research Council, Edmonton, Canada). The mixtures were incubated at 37°C for 2 h (FUT7 and FUT9) or for 1 h (all others). The reactions were stopped by addition of 3 ml of water and then centrifuged, and the supernatant was applied to a conditioned Sep-Pak C18 reverse chromatography cartridge (Waters, Milford) (Palcic et al., 1988
; Fernandez-Mateos et al., 1998
). Enzyme kinetic parameters were determined for FUT3, FUT4, FUT6, and FUT9 enzymes under conditions corresponding to initial velocity with respectively, 20, 12.5, 40, or 25 µg protein aliquots and 15 (FUT3), 30 (FUT4), or 60 (FUT6, FUT9) min incubation at 37°C. Apparent Km were calculated for GDP-fucose (range of concentrations, 4250 µM), H-type-2 (20890 µM for FUT4, FUT6, and FUT9 or 0.14.4 mM for FUT3), H-type-1 (20890 µM for FUT3) from Lineweaver-Burk plots of initial rate data. When Km was calculated for GDP-fucose, H-type-2 or H-type-1 concentrations were 300 µM. When Km was calculated for H-type-2 or H-type-1 the concentration for GDP-fucose was 230 µM for FUT4 and FUT9 or 120 µM for FUT3 and FUT6.
PCR on genomic DNA of hybrid cell lines for chromosome localization of the FUT9 gene
A total of 53 humanrodent interspecific hybrid cell lines were tested. Ten monochromosomal lines were obtained from the ATCC. Twenty-four were from a panel (Nguyen van Cong et al., 1986
) and the remaining 19 clones were prepared by P.Coullin (Couillin et al., 1994
; Reguigne-Arnould et al., 1995
, 1996). The PCR for the detection of FUT9 gene was performed with 200 ng of each hybrid genomic DNA in a 50 µl reaction volume containing: 1x PCR buffer and 1 unit of Taq Polymerase from MBI-Fermentas, 200 µM of dNTPs, 2 mM MgCl2, 0.2 µM of each FUT9 primer (hF9-s and hF9-1260as; Table I). The PCR program comprises: initial denaturation 94°C 5 min, followed by 38 cycles of 94°C 45 s, 52°C 45 s, 72°C for 2 min 30 s, and final extension of 72°C 8 min. A FUT9 specific PCR product of 808 bp is obtained when hybrids have the FUT9 gene.
Cytogenetic localization
Slides using standard cytogenetic methods were prepared from lymphocytes of healthy donors. Biotinylated probes from BACs: B601c3 and H330e11 were obtained by nick-translation using the kit proposed by GIBCO BRLR. Regional assignment was performed by simultaneous visualization of FISH signals and the R-banding pattern generated by PRINS (Coullin et al., 1999
). Briefly, preparations were first treated by PRINS and then used for FISH. The slides were denatured in 70% formamide at 70°C for 2 min and PRINS reactions were conducted (Coullin et al., 1997
) using the Alu S sequence (5'GCCACTGCACTCCAGCCTGGG3') as primers and digoxigenin-11-dUTP as labeled nucleotide. After denaturation (80°C for 5 min) and the competition phase (37°C for 1 h 30 min), the hybridization mixture containing the probe (40 ng/8 µg human Cot-1TM DNA) was deposited onto the PRINS pretreated slides. FISH procedures were performed directly on these slides (Goguel et al., 1996
). The PRINS staining was revealed during the last post-hybridization treatment using anti-digoxigenin-rhodamine. The BAC probe signal was revealed with avidin-FITC. The preparation was counterstained with DAPI and examined under an epifluorescence microscope (Zeiss Axiophot). Numerized pictures were obtained using a tri-CCD camera and the Vysis computer program for image storing.
| Acknowledgments |
|---|
|
|
|---|
We are greatly indebted for help in the construction of the embryo cDNA libraries to the laboratory of J.B.Lowe (Ann Arbor, MI) and to M.Palcic for the generous supply of synthetic lac-di-NAc-O-R acceptor, to A.Barbat for photographic help, and to S.Moore for revision of the manuscript. This work has been partly supported by INSERM, CNRS, the shared cost Xenotransplantation contract IO4-CT97-2242 from the Immunology Biotechnology program DG XII from the European Union (EU), and the French network of Recombinant Glycosyltransferases (GT-rec).
| Abbreviations |
|---|
|
|
|---|
BAC, bacterial artificial chromosome; cds, coding sequence; d, day; FISH, fluorescence in situ hybridization; FUT1 to FUT9, Genome Data Base (GDB) names of the human
-fucosyltransferase genes; plain FUT1 to FUT9 are used for the enzymes encoded by the FUT1 to FUT9 genes, which are in italic characters; NEM, N-ethylmaleimide; PCR, polymerase chain reaction; PRINS, primed in situ labeling; RACE, rapid amplification cDNA ends; RT, reverse transcriptase.
| Footnotes |
|---|
1 To whom correspondence should be addressed at: U 504 INSERM, 16 Av. Paul Vaillant-Couturier, 94807 Villejuif CEDEX, France
| References |
|---|
|
|
|---|
Ashwell,K.W. and Mai,J.K. (1997) Developmental expression of the CD15 epitope in the hippocampus of the mouse. Cell Tissue Res., 289, 1723.[Web of Science][Medline]
Bengston,P., Börjeson,C., Lundblad,A., Larson,G. and Pahlsson,P. (1999) A novel mutation in the human FUT7 gene. Glycoconjugate J., 16, S48 (abstract).
Cameron,H.S., Szczepaniak,D. and Weston,B.W. (1995) Expression of human chromosome 19p
(1,3)-fucosyltransferase genes in normal tissuesalternative splicing, polyadenylation and isoforms. J. Biol. Chem., 270, 2011220122.
Candelier,J.J., Mollicone,R., Mennesson,B., Bergemer,A.M., Henry,S., Coullin,P. and Oriol,R. (1993)
-3-Fucosyltransferases and their glycoconjugate antigen products in the developing human kidney. Lab. Invest., 69, 449459.[Web of Science][Medline]
Clarke,J.L. and Watkins,W.M. (1996)
1,3-L-Fucosyltransferase expression in developing human myeloid cells. Antigenic, enzymatic and mRNA analyses. J. Biol. Chem., 271, 1031710328.
Costache,M., Apoil,P., Cailleau,A., Elmgren,A., Larson,G., Henry,S., Blancher,A., Iordachescu,D., Oriol,R. and Mollicone,R. (1997) Evolution of fucosyltransferase genes in vertebrates. J. Biol. Chem., 272, 2972129728.
Couillin,P., Mollicone,R., Grisard,M.C., Gibaud,A., Ravisé,N., Feingold,J. and Oriol,R. (1991) Chromosome 11q localization of one of the three expected genes for the human
-3-fucosyltransferases, by somatic hybridization. Cytogenet. Cell Genet., 56, 108111.[Web of Science][Medline]
Couillin,P., Le Guern,E., Vignal,A., Fizames,C., Ravise,N., Delportes,D., Reguigne,I., Rosier,M.F., Junien,C., vanHeyningen,V. and Weissenbach,J. (1994) Assignment of 112 microsatellite markers to 23 chromosome 11 subregions delineated by somatic hybrids: comparison with the genetic map. Genomics, 21, 379387.[Web of Science][Medline]
Coullin,P., Andreo,B., Charlieu,J.P., Candelier,J.J. and Pellestor,F. (1997) Primed in situ (PRINS) labelling with Alu and satellite primers for rapid characterization of human chromosome in hybrid cell lines. Chromosome Res., 5, 307312.[Web of Science][Medline]
Coullin,P., Philippe,C., Ravise,N. and Bernheim,A. (1999) Primed in situ labelling (PRINS), a simple method for simultaneous R-banding and fluorescence in situ hybridization (FISH). Chromosome Res., 7, 241242.[Web of Science][Medline]
Davis,L.G., Dibner,M.D. and Battey,J.F. (1986) Basic Methods in Molecular Biology. Elsevier Science Publishing, New York.
Dupuy,F., Petit,J.M., Mollicone,R., Oriol,R., Julien,R. and Maftah,A. (1999) A single amino acid in the hypervariable stem domain of vertebrate
1,3/1,4-fucosyltransferases determines the type 1 type 2 transfercharacterization of acceptor substrate specificity of the Lewis enzyme by site-directed mutagenesis. J. Biol. Chem., 274, 1225712262.
Fenderson,B.A., Zehavi,U. and Hakomori,S. (1984) A multivalent lacto-N-fucopentaose III-lysyllysine conjugate decompacts preimplantation-stage mouse embryos, while the free oligosaccharide is ineffective. J. Exp. Med., 160, 15911596.
Fernandez-Mateos,P., Cailleau,A., Henry,S., Costache,M., Elmgren,A., Svenson,L., Larson,G., Samuelsson,B.E., Oriol,R. and Mollicone,R. (1998) Point mutations and deletion responsible for the Bombay H null and the Reunion H weak blood groups. Vox Sang., 75, 3746.[Web of Science][Medline]
Gersten,K.M., Natsuka,S., Trinchera,M., Petryniak,B., Kelly,R.J., Hiraiwa,N., Jenkins,N.A., Gilbert,D.J., Copeland,N.G. and Lowe,J.B. (1995) Molecular cloning, expression, chromosomal assignment and tissue-specific expression of murine
- (1,3)-fucosyltransferase locus corresponding to the human ELAM-1 ligand fucosyltransferase. J. Biol. Chem., 270, 2504725056.
Gocht,A. (1992) The subcellular localization of the carbohydrate epitope 3-fucosyl-N-acetyllactosamine is different in normal and reactive astrocytes. Acta Anat., 145, 434441.[Web of Science][Medline]
Goelz,S.E., Hession,C., Goff,D., Griffiths,B., Tizard,R., Newman,B., Chi-Rosso,G. and Lobb,R. (1990) ELFT: A gene that directs the expression of an ELAM-1 ligand. Cell, 63, 13491356.[Web of Science][Medline]
Goguel,A.F., Pulcini,F., Danglot,G., Fauvet,D., Devignes,M.D. and Bernheim,A. (1996) Mapping of 22 YACs on human chromosomes by FISH using yeast DNA Alu-PCR products for competition. Ann. Genet., 39, 6468.[Web of Science][Medline]
Hakomori,S. (1998) Cancer-associated glycosphingolipid antigens: their structure, organization and function. Acta Anat., 161, 7990.[Web of Science][Medline]
Holmes,E.H., Xu,Z.H., Sherwood,A.L. and Macher,B.A. (1995) Structurefunction analysis of human
13fucosyltransferasesa GDP-fucose-protected, N-ethylmaleimide-sensitive site in FucT-III and FucT-V corresponds to Ser (178) in FucT-IV. J. Biol. Chem., 270, 81458151.
Johnston,D.S., Wright,W.W., Shaper,J.H., Hokke,C.H., van den Eijnden,D.H. and Joziasse,D.H. (1998) Murine sperm-zona binding, a fucosyl residue is required for a high affinity sperm-binding ligand. J. Biol. Chem., 273, 18881895.
Kageyama,N., Natsuka,S. and Hase,S. (1999) Molecular cloning and characterizeation of two zebrafish
(1,3)fucosyltransferase genes developmentally regulated in embryogenesis. J. Biochem., 125, 838845.
Kaneko,M., Kudo,T., Iwasaki,H., Ikehara,Y., Nishihara,S., Nakagawa,S., Sasaki,K., Shiina,T., Inoko,H., Saitou,N. and Narimatsu,H. (1999a)
1,3-fucoslytransferase IX (Fuc-TIX) is very highly conserved between human and mouse; molecular cloning, characterization and tissue distribution of human Fuc-TIX. FEBS Lett., 452, 237242.[Web of Science][Medline]
Kaneko,M., Kudo,T., Iwasaki,H., Shiina,T., Inoko,H., Kozaki,T., Saitou,N. and Narimatsu,H. (1999b) Assignment of the human
1,3-fucosyltransferase IX gene (FUT9) to chromosome band 6q16 by in situ hybridization. Cytogenet. Cell Genet., 86, 329330.[Web of Science][Medline]
Kudo,T., Ikehara,Y., Togayachi,A., Kaneko,M., Hiraga,T., Sasaki,K. and Narimatsu,H. (1998) Expression cloning and characterization of a novel murine
1,3-fucosyltransferase, mFuc-TIX, that synthesizes the Lewis x (CD15) epitope in brain and kidney. J. Biol. Chem., 273, 2672926738.
Kukowska-Latallo,J.F., Larsen,R.D., Nair,R.P. and Lowe,J.B. (1990) A cloned human cDNA determines expression of a mouse stage-specific embryonic antigen and the Lewis blood group
(1,3/1,4)fucosyltransferase. Genes Dev., 4, 12881303.
Liu,N., Jin,C., Zhu,Z.M., Zhang,J., Tao,H., Ge,C., Yang,S. and Zhang,S. (1999) Stage-specific expression of
1,2-fucosyltransferase and
1,3-fucosyltransferase (FT) during mouse embryogenesis. Eur. J. Biochem., 265, 258263.[Web of Science][Medline]
Lowe,J.B., Kukowska-Latallo,J.F., Nair,R.P., Larsen,R.D., Marks,R.M., Macher,B.A., Kelly,R.J. and Ernst,L.K. (1991) Molecular cloning of a human fucosyltransferase gene that determines expression of the Lewis x and VIM-2 epitopes but not ELAM-1-dependent cell adhesion. J. Biol. Chem., 266, 1746717477.
Mai,J.K., Winking,R. and Ashwell,K.W. (1999) Transient CD15 expression reflects stages of differentiation and maturation in the human subcortical central auditory pathway. J. Comp. Neurol., 404, 197211.[Web of Science][Medline]
Miyake,M., Zenita,K., Tanaka,O., Okada,Y. and Kannagi,R. (1988) Stage-specific expression of SSEA-1-related antigens in the developing lung of human embryo and its relation to the distribution of these antigens in lung cancers. Cancer Res., 48, 71507158.
Mollicone,R., Bara,J., Le Pendu,J. and Oriol,R. (1985) Immunohistologic pattern of type 1 (Lea, Leb) and type 2 (X, Y, H) blood group related antigens in the human pyloric and duodenal mucosa. Lab. Invest., 53, 219227.[Web of Science][Medline]
Mollicone,R., Gibaud,A., François,A., Ratcliffe,M. and Oriol,R. (1990) Acceptor specificity and tissue distribution of three human
-3-fucosyltransferases. Eur. J. Biochem., 191, 169176.[Web of Science][Medline]
Mollicone,R., Candelier,J.J., Mennesson,B., Couillin,P., Venot,A.P. and Oriol,R. (1992) Five specificity patterns of (13)-
-L-fucosyltransferase activity defined by use of synthetic oligosaccharide acceptors. Differential expression of the enzymes during human embryonic development and in adult tissues. Carbohydrate Res., 228, 265276.
Morres,S.A., Mai,J.K. and Teckhaus,L. (1992) Expression of the CD15 epitope in the human magnocellular basal forebrain system. Histochem. J., 24, 902909.[Web of Science][Medline]
Natsuka,S., Gersten,K.M., Zenita,K., Kannagi,R. and Lowe,J.B. (1994) Molecular cloning of a cDNA encoding a novel human leukocyte
-1,3-fucosyltransferase capable of synthesizing the sialyl-Lewis x determinant. J. Biol. Chem., 269, 1678916794.
Nguyen van Cong,N., Weil,D., Finaz,C., Cohen-Hagnenauer,O., Gross,M.S., Jegob-Fonbert,C., de Tand,M.F., Cochet,C., de Grouchy,J. and Frezal,J. (1986) Panel of twenty-five independent man-rodent hybrids for human genetic marker mapping. Ann. Genet., 29, 2026.[Web of Science][Medline]
Oriol,R., Mollicone,R., Cailleau,A., Balanzino,L. and Breton,C. (1999) Divergent evolution of fucosyltransferase genes from vertebrates, invertebrates and bacteria. Glycobiology, 9, 323334.
Ørntoft,T.F. and Vestergaard,E.M. (1999) Clinical aspects of altered glycosylation of glycoproteins in cancer. Electrophoresis, 20, 362371.[Web of Science][Medline]
Palcic,M.M., Heerze,L.D., Pierce,M. and Hindsgaul,O. (1988) The use of hydrophobic synthetic glycosides as acceptors in glycosyltransferase assays. Glycoconjugate J., 5, 4963.
Reguigne,I., James,M.R., Richard,C.W.,III, Mollicone,R., Seawright,A., Lowe,J.B., Oriol,R. and Couillin,P. (1994) The gene of the myeloid
-3-fucosyltransferase (FUT4) is located between D11S388 and D11S919 on 11q21. Cytogenet. Cell Genet., 66, 104106.[Web of Science][Medline]
Reguigne-Arnould,I., Couillin,P., Mollicone,R., Faure,S., Fletcher,A., Kelly,R.J., Lowe,J.B. and Oriol,R. (1995) Relative positions of two clusters of human
-L-fucosyltransferases in 19q (FUT1-FUT2) and 19p (FUT6-FUT3-FUT5) within the microsatellite genetic map of chromosome 19. Cytogenet. Cell Gen., 71, 158162.[Web of Science][Medline]
Reguigne-Arnould,I., Wolfe,J., Hornigold,N., Faure,S., Mollicone,R., Oriol,R. and Couillin,P. (1996) Fucosyltransferase genes are dispersed in the genome: FUT7 is located on 19q34.3 distal to D9S1830. C. R. Acad. Sci. Paris, 319, 783788.
Sasaki,K., Kurata,K., Funayama,K., Nagata,M., Watanabe,E., Ohta,S., Hanai,N. and Nishi,T. (1994) Expression cloning of a novel
1,3-fucosyltransferase that is involved in biosynthesis of the sialyl Lewis x carbohydrate determinants in leukocytes. J. Biol. Chem., 269, 1473014737.
Smith,P.L., Gersten,K.M., Petryniak,B., Kelly,R.J., Rogers,C., Natsuka,Y., Alford,J.A., Scheidegger,E.P., Natsuka,S. and Lowe,J.B. (1996) Expression of the
(1,3)fucosyltransferase Fuc-TVII in lymphoid aggregate high endothelial venules correlates with expression of L-selectin ligands. J. Biol. Chem., 271, 82508259.
Tuo,X.H., Itai,S., Nishikata,J., Mori,T., Tanaka,O. and Kannagi,R. (1992) Stage-specific expression of cancer-associated type 1 and type 2 chain polylactosamine antigens in the developing pancreas of human embryos. Cancer Res., 52, 57445751.
Wadel,T.K., Fialkov,L., Chan,C.K., Kishimoto,T.K. and Downey,G.P. (1995) Signaling functions of L-selectin: enhancement of tyrosine phosphorylation and activation of MAP kinase. J. Biol. Chem., 270, 1540315411.
Weston,B.W., Hiller,K.M., Mayben,J.P., Manousos,G., Nelson,C.M., Klein,M.B. and Goodman,J.L. (1999) A cloned CD15s-negative variant of HL60 cells is deficient in expression of FUT7 and does not adhere to cytokine-stimulated endothelial cells. Eur. J. Haematol., 63, 4249.[Web of Science][Medline]
Weston,B.W., Nair,R.P., Larsen,R.D. and Lowe,J.B. (1992) Isolation of a novel human
(1,3)fucosyltransferase gene and molecular comparison to the human Lewis blood group
(1,3/1,4)fucosyltransferase gene. J. Biol. Chem., 267, 41524160.
Weston,B.W., Smith,P.L., Kelly,R.J. and Lowe,J.B. (1992a) Molecular cloning of a fourth member of a human
(1,3)fucosyltransferase gene family. J. Biol. Chem., 267, 2457524584.
Yago,K., Zenita,K., Ginya,H., Sawada,M., Ohmorik,K., Okuma,M., Kannagi,R. and Lowe,J. (1993) Expression of
(1,3)-fucosyltransferases which synthesize sialyl-Lex and sialyl-Lea, the carbohydrate ligands for E- and P-selectines in human malignant cells. Cancer Res., 53, 55595565.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
R. Mollicone, S. E. H. Moore, N. Bovin, M. Garcia-Rosasco, J.-J. Candelier, I. Martinez-Duncker, and R. Oriol Activity, Splice Variants, Conserved Peptide Motifs, and Phylogeny of Two New {alpha}1,3-Fucosyltransferase Families (FUT10 and FUT11) J. Biol. Chem., February 13, 2009; 284(7): 4723 - 4738. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Allahverdian, K. R. Wojcik, and D. R. Dorscheid Airway epithelial wound repair: role of carbohydrate sialyl Lewisx Am J Physiol Lung Cell Mol Physiol, October 1, 2006; 291(4): L828 - L836. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. S. Kawar, S. M. Haslam, H. R. Morris, A. Dell, and R. D. Cummings Novel Poly-GalNAc{beta}1-4GlcNAc (LacdiNAc) and Fucosylated Poly-LacdiNAc N-Glycans from Mammalian Cells Expressing {beta}1,4-N-Acetylgalactosaminyltransferase and {alpha}1,3-Fucosyltransferase J. Biol. Chem., April 1, 2005; 280(13): 12810 - 12819. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Martinez-Duncker, T. Dupre, V. Piller, F. Piller, J.-J. Candelier, C. Trichet, G. Tchernia, R. Oriol, and R. Mollicone Genetic complementation reveals a novel human congenital disorder of glycosylation of type II, due to inactivation of the Golgi CMP-sialic acid transporter Blood, April 1, 2005; 105(7): 2671 - 2676. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kudo, M. Kaneko, H. Iwasaki, A. Togayachi, S. Nishihara, K. Abe, and H. Narimatsu Normal Embryonic and Germ Cell Development in Mice Lacking {alpha}1,3-Fucosyltransferase IX (Fut9) Which Show Disappearance of Stage-Specific Embryonic Antigen 1 Mol. Cell. Biol., May 15, 2004; 24(10): 4221 - 4228. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Martinez-Duncker, J.-C. Michalski, C. Bauvy, J.-J. Candelier, B. Mennesson, P. Codogno, R. Oriol, and R. Mollicone Activity and tissue distribution of splice variants of {alpha}6-fucosyltransferase in human embryogenesis Glycobiology, January 1, 2004; 14(1): 13 - 25. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Martinez-Duncker, R. Mollicone, J.-J. Candelier, C. Breton, and R. Oriol A new superfamily of protein-O-fucosyltransferases, {alpha}2-fucosyltransferases, and {alpha}6-fucosyltransferases: phylogeny and identification of conserved peptide motifs Glycobiology, December 1, 2003; 13(12): 1C - 5C. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Oriol, I. Martinez-Duncker, I. Chantret, R. Mollicone, and P. Codogno Common Origin and Evolution of Glycosyltransferases Using Dol-P-monosaccharides as Donor Substrate Mol. Biol. Evol., September 1, 2002; 19(9): 1451 - 1463. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Toivonen, S. Nishihara, H. Narimatsu, O. Renkonen, and R. Renkonen Fuc-TIX: a versatile {alpha}1,3-fucosyltransferase with a distinct acceptor- and site-specificity profile Glycobiology, June 1, 2002; 12(6): 361 - 368. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. de Vries, R. M.A. Knegtel, E. H. Holmes, and B. A. Macher Fucosyltransferases: structure/function studies Glycobiology, October 1, 2001; 11(10): 119R - 128R. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||












