Glycobiology, 2000, Vol. 10, No. 5 531-583
© 2000 Oxford University Press
Minimal structural and glycosylation requirements for ST6Gal I activity and trafficking
Department of Biochemistry and Molecular Biology, University of Illinois at Chicago, College of Medicine, Chicago, IL 60612, USA
Received on November 12, 1999; accepted on December 8, 1999.
| Abstract |
|---|
|
|
|---|
The influence of N-linked glycosylation on the activity and trafficking of membrane associated and soluble forms of the STtyr isoform of the ST6Gal I has been evaluated. We have demonstrated that the enzyme is glycosylated on Asn 146 and Asn 158 and that glycosylation is not required for the endoplasmic reticulum to Golgi transport of the membrane-associated form of the STtyr isoform. In addition, N-linked glycosylation may stabilize the protein but is not absolutely required for catalytic activity in vivo. In contrast, soluble forms of the protein consisting of amino acids 64403, 89403, and 97403 are efficiently secreted and active in their fully glycosylated forms, but retained in the endoplasmic reticulum and inactive in their unglycosylated forms. These results suggest that membrane associated and soluble forms of the STtyr protein have different requirements for N-linked glycosylation. Elimination of the oligosaccharide attached to Asn 158 in the full length STtyr single and double glycosylation mutants generates proteins that are not cleaved and secreted but stably localized in the Golgi, like the STcys isoform of the ST6Gal I. This stable Golgi localization is correlated with the observation that these two mutants are active in in vivo assays but inactive in in vitro assays of membrane lysates. We predict that removal of N-linked oligosaccharides leads to an increased ability of the STtyr protein to self-associate or oligomerize which subsequently allows more stable retention in the Golgi and increased aggregation and inactivity when membranes are lysed in the in vitro activity assays.
Key words: glycosylation/ST6Gal/transport/activity
| Introduction |
|---|
|
|
|---|
The ST6Gal I (
2, 6-sialyltransferase) modifies N-linked oligosaccharides on glycoproteins as they traverse the later compartments of the Golgi apparatus. This enzymes sialylated products are important in maintaining proteins in the circulation, are used as receptors for influenza virus, and as receptors for the CD22 lectin which has a role in B cell activation and maturation (reviewed in Varki, 1993
Our laboratory recently found that the ST6Gal I is expressed as two isoforms with a single amino acid difference at position 123 in their catalytic domains. The STtyr isoform is found in the Golgi, at low levels on the cell surface, is cleaved in a post-Golgi compartment, and secreted into the extracellular space with a half-time of 36 h in COS and HeLa cells (Ma et al., 1997
). In contrast, the STcys isoform is stably retained in the cell, exhibiting predominantly Golgi staining when moderately expressed, and ER and Golgi staining when more highly expressed (Ma et al., 1997
). Both isoforms are active in vivo when expressed in CHO cells, but the STcys isoform exhibits a 5- to 6-fold lower catalytic activity when assayed in vitro. These findings suggested that the differences in conformation of the two isoforms are responsible for their differences in their trafficking and activity. For this reason we became interested in determining structure of ST isoforms to establish basis for these differences. In order to do this, we first had to define minimal structural and glycosylation requirements for an active ST6Gal I protein.
Previous work suggested that N-glycosylation was critical for ST6Gal I activity. Fast et al. (1993)
enzymatically deglycosylated a purified ST6Gal I and found that removal of terminal sialic acid and galactose residues had little effect on activity, but that removal of terminal GlcNAc residues significantly decreased catalytic activity. They also observed that removal of all the N-linked oligosaccharides almost completely inactivated the enzyme when analyzed by in vitro assays. These researchers did not eliminate N-linked glycosylation sites by mutagenesis or analyze in vivo activity of deglycosylated forms.
Work by Weinstein et al. (1987)
showed that a truncated form of the ST6Gal I was formed during purification from rat liver. Amino terminal sequencing demonstrated that the first amino acid of the truncated form was Ser 64 and they predicted that the ST6Gal I is cleaved between Asn 63 and Ser 64, and that this cleavage leads to the generation of the soluble form which is found in body fluids. These researchers defined the stem-catalytic domain border based on this cleavage site. However, recent work in our laboratory demonstrated another primary (Lys40-Glu41), and several secondary sites of cleavage, result in the secretion of active, soluble forms of the STtyr from COS cells (Kitazume-Kawaguchi et al., 1999
). We found that deletion of amino acids 3286 resulted in a form of the enzyme that was active, cleaved and secreted, while deletion of amino acids 32104 resulted in an inactive form of the enzyme that localized in the Golgi, but not cleaved and secreted. These results suggested that the stem-catalytic domain border is much further C-terminal than previously supposed and most likely found somewhere between amino acids 86 and 104.
In this work, we have identified the ST6Gal I Asn residues used for N-linked glycosylation and determined whether the attached oligosaccharides are required for activity and trafficking of both membrane associated and soluble forms of the STtyr isoform. In addition, several different soluble constructs were made to define the minimum sequences required for activity and we demonstrated that a soluble form of the protein comprised of amino acids 97403 is completely active. We have found that glycosylation is not required for the activity of membrane associated STtyr, but is required for the activity and trafficking of soluble forms of the enzyme. Interestingly, mutagenesis of Asn 158 and elimination of the oligosaccharide attached at that site, influences the trafficking of the STtyr isoform converting it to a form that behaves like the STcys isoform, in that it is not cleaved and secreted from COS-1 cells, but stably localized in the Golgi.
| Results |
|---|
|
|
|---|
Sites of ST6Gal I Asn-linked glycosylation
In order to determine whether N-linked oligosaccharides are required for ST6Gal I activity, we first had to determine which Asn consensus sites are glycosylated. There are three potential N-linked glycosylation sites in the ST6Gal I: Asn 146 (Asn-Val-Ser), Asn 158 (Asn-Thr-Thr), and Asn 285 (Asn-Pro-Ser). Work done by Weinstein et al. (1987)
|
Impact of removing N- linked glycosylation sites on protein trafficking and activity
N-Linked oligosaccharides are added cotranslationally and have been shown to impact the folding of proteins (reviewed in Varki, 1993
|
The STtyr isoform of the ST6Gal I is transiently localized in the Golgi and then is cleaved and secreted, probably in a post-Golgi compartment (Ma et al., 1997
|
Previous work by Fast et al. (1993)
2, 6-linked sialic acid (Shibuya et al., 1987
We also analyzed the catalytic activity of the three glycosylation mutants in vitro and compared their activities to the wild-type STtyr. Using a standard sialyltransferase assay with immobilized asialofetuin as a substrate and CMP-[14C]NeuAc as the donor, we found that the N146S mutant was 68% as active as the wild-type STtyr, while both the N158Q and N146S/N158Q mutants were completely inactive in this assay system (Table I). This was surprising since in the in vivo assay all three of the glycosylation mutants exhibited catalytic activity. One possibility was that the mutant forms containing the N158Q mutation are more prone to aggregation or degradation when membranes are lysed. Recent results strongly suggest the former possibility (Chen et al., 2000
).
|
Minimal length of the catalytic domain of the ST6Gal I
In order to generate soluble, active forms of the enzyme for structural analysis, we wanted to determine the minimal size of the catalytic domain. Recently, our laboratory found that deleting stem amino acids 3286 led to the generation of an active, secreted form of the STtyr that was cleaved by an endogenous protease in COS cells (Kitazume-Kawaguchi et al., 1999
|
Expression of spWT1, spWT2, and spWT3 in CHO cells followed by SNA staining revealed that all three soluble proteins were active in vivo as they traversed the secretory pathway (data not shown). In vitro enzymatic analyses revealed that the secreted forms of spWT1, spWT2, and spWT3 were comparably active when asialofetuin is used as a substrate (Table I, lower section). These results suggested that the spWT3 protein could be used in vitro as an active form of the enzyme. In addition, this data demonstrated that the catalytic domain of the enzyme is actually smaller than previously supposed.
Impact of N-linked oligosaccharides on activity and trafficking of soluble ST6Gal I forms
To determine whether N-linked oligosaccharides were required for the activity or trafficking of these soluble forms, we introduced the N146S/N158Q mutation into spWT1 and spWT3. We found that neither of these proteins were secreted from the cell (Figure 4, spD1 and spD3). In addition, neither of the deglycosylated soluble proteins were active in the in vivo CHO cell/SNA assay (data not shown). These results suggested that they were retained in the endoplasmic reticulum. This was confirmed by indirect immunofluorescence microscopy (data not shown). It is clear that the N-linked oligosaccharides are required for the correct folding of the soluble ST6Gal I proteins into forms competent to be transported from the endoplasmic reticulum to the Golgi; however, there was still a possibility that these unglycosylated soluble forms were catalytically active. To investigate this possibility, we assayed cell lysates using the sialyltransferase assay described above. We found that neither the unglycosylated spD1 or spD3 proteins were active in this assay. We conclude that the membrane associated and soluble forms of the STtyr protein have different requirements for N-linked glycosylation. The transmembrane STtyr does not require N-linked oligosaccharides for transport from the endoplasmic reticulum to the Golgi but does require an oligosaccharide on Asn 158 for transport beyond the Golgi. In addition, elimination of both N-linked oligosaccharides does not completely inactive the membrane associated enzyme. In contrast, soluble forms of the enzyme seem to require N-linked oligosaccharides for folding into structures competent to exit the endoplasmic reticulum and for catalytic activity.
| Discussion |
|---|
|
|
|---|
In this work, we have established that the N-linked oligosaccharides of the ST6Gal I STtyr isoform are not absolutely required for in vivo activity or endoplasmic reticulum to Golgi transport of the membrane associated form. In contrast, the N-linked oligosaccharides are required for activity and endoplasmic reticulum to Golgi transport of the soluble forms of this protein. However, we cannot rule out the possibility that unglycosylated soluble forms of the STtyr appear inactive in the in vitro assay due to aggregation or degradation following membrane lysis. Interestingly, elimination of the oligosaccharide on Asn 158 generates a form of the membrane associated STtyr that behaves like the STcys isoform in that it is localized in the Golgi but never cleaved and secreted, presumably because it is unable to move into the post-Golgi cleavage compartment. Analyses of three different soluble, truncated forms of the ST6Gal I STtyr isoform demonstrated that a soluble protein consisting of amino acids 97403 is catalytically active and demonstrates that the catalytic domain is over 30 amino acids smaller than previously suggested (Weinstein et al., 1987
The N-linked glycosylation of proteins occurs cotranslationally with the transfer of a Glc3Man9GlcNAc2 precursor structure from dolichol to an Asn-X-Ser/Thr sequence in a nascent protein (Kornfeld and Kornfeld, 1985
). Many times the presence of these large N-linked oligosaccharides is required for the correct folding of the protein. Preventing N-linked glycosylation by the addition of tunicamycin or by expressing glycosylation site (Asn) mutants can lead to misfolded proteins that are inactive and/or retained in the endoplasmic reticulum via interaction with chaperones (reviewed in Varki, 1993
). In addition, eliminating the N-linked oligosaccharides of a glycoprotein may not impact its folding or activity directly, but may make it more susceptible to degradation as it traverses the secretory pathway (reviewed in Varki, 1993
). We found that eliminating one or both of the N-linked oligosaccharides of the ST6Gal I STtyr isoform did not inactivate the enzyme or prevent it from being transported from the endoplasmic reticulum to the Golgi. However, other researchers investigating the role of N-linked oligosaccharides in the activity and trafficking of other glycosyltransferases have obtained different results. Using tunicamycin, an inhibitor of N-linked glycosylation, Martina et al. (1998)
and Nagai et al. (1997)
found that N-linked oligosaccharides are critical for the transport of the GD3 synthase and ß-1, 4-N-acetylglucosaminyltransferase III (GnTIII) from the endoplasmic reticulum to the Golgi. The unglycosylated GD3 synthase was inactive in an in vitro assay, while the activity of the unglycosylated GnTIII was substantially reduced in an in vitro assay. Using Asn mutants, Nagai et al. (1997)
further demonstrated that individually eliminating the three N-linked glycosylation sites led to the endoplasmic reticulum retention of each mutant and a corresponding decrease in activity in the in vitro assay. For these enzymes, it appears that their N-linked oligosaccharides are required for both their endoplasmic reticulum to Golgi transport and their catalytic activity in an in vitro assay. In another study, Toki et al. (1997)
found that eliminating two N-linked oligosaccharides from the ß1,6-N-acetylglucosaminyltransferase (C2GnT) led to a loss of enzymatic activity due partially to protein degradation.
We used two different assays to determine whether the glycosylation mutants and soluble forms of the ST6Gal I STtyr isoform are active. The in vitro assay involves incubating radiolabeled sugar nucleotide donor and immobilized asialoglycoprotein acceptor with detergent-solubilized membranes from cells expressing the wild type STtyr, its mutants or soluble forms. The in vivo assay involves expressing the wild type STtyr, its mutants, or soluble forms in CHO cells and assaying for activity by determining whether FITC-conjugated SNA lectin recognizes and binds glycoconjugates bearing terminal
2, 6-linked sialic acid. The in vivo assay depends on the enzyme being transported into or through the Golgi compartment that contains its sugar nucleotide donor and the appropriate glycoprotein substrates. Surprisingly, we found that these two assays gave different results for the Golgi localized N158Q and N146S/N158Q glycosylation mutants. These proteins are active in the in vivo assay, and inactive in the in vitro assay.
Similar results were obtained by Haraguchi et al. (1995)
in their elegant study of the role of glycosylation in the trafficking and activity of the ß-1, 4-N-acetylgalactosaminyltransferase (GM2 synthase). As in this work, elimination of all N-linked oligosaccharides of the GM2 synthase by site directed mutagenesis generated a Golgi localized protein that was inactive in their in vitro assay but active in vivo as determined by flow cytometry analysis using an anti-GM2 monoclonal antibody to detect enzyme product. They observed no difference in the amount of product generated in vivo when wild type enzyme or the single, double or triple glycosylation mutants were expressed in KF3027 cells. In contrast, they found that the fewer N-linked oligosaccharides modifying the GM2 synthase, the less active the enzyme appeared in the in vitro assay. Kinetic analysis suggested that GM2 synthase oligosaccharides play no role in substrate interaction. From their results, the authors concluded that the oligosaccharides of the GM2 synthase allow the protein to maintain a stable enzyme structure and in this way are critical for maximum enzyme activity.
The differences in the in vitro and in vivo activity observed in our laboratory for the glycosylation mutants of the ST6Gal I and by Haraguchi et al. (1995)
for the glycosylation mutants of the GM2 synthase could be the result of any number of assay limitations. Haraguchi et al. (1995)
suggest that the catalytic reaction in their transient transfectants might be limited by levels of endogenous cellular components besides the expressed GM2 synthase itself, so that differences observed in vitro might not be observed in vivo. In our experiments we detect no activity in vitro for the N158Q and N146S/N158Q mutants but find that they are active in the in vivo assay. We propose that removing oligosaccharides from the ST6Gal I protein can destabilize the protein by making it more susceptible to proteolysis and/or increase its propensity for self-association. In support of the first of these possibilities, we observe that the double glycosylation mutant is found in a lower amount than the single glycosylation mutants or the wild type protein suggesting it may be more susceptible to degradation. The lower levels of N146S/N158Q mutant protein observed in cells correlates well with the lower levels of SNA staining observed for cells expressing this mutant. In support of the second possibility, we find that the lack of activity in the in vitro assay also correlates with the N158Q and N146S/N158Q mutants lack of cleavage and secretion from COS cells. These mutant STtyr proteins now behave like the STcys protein. We propose that the STcys protein forms more stable oligomers than the STtyr isoform and that this is the basis for its stable localization in the Golgi. It is possible that removing the oligosaccharide at position 158 allows the STtyr to form more stable oligomers and be more stably localized in the Golgi. This increased ability to self-associate may lead to these proteins aggregation into inactive forms when cell membranes are lysed as in the in vitro assay. Recently we have tested this premise and found that the N158Q mutant, like the STcys, forms insoluble oligomers under specific membrane lysis conditions, while the STtyr does not or does to a lesser degree (Chen et al., 2000
).
Several years ago, Guan and Rose (1984) observed that fusing the cytoplasmic and transmembrane regions of vesicular stomatitis virus G protein to the soluble rat growth hormone allowed this chimeric protein to be transported as far as the Golgi apparatus but not to the cell surface. Only after N-linked glycosylation sites were added to the rat growth hormone sequence, and these sites glycosylated, was this chimeric protein transported to the cell surface (Guan et al., 1985
). These researchers concluded that "N-linked glycosylation can serve as signal for protein transport to the cell surface." More recently, Scheiffele et al. (1995)
obtained evidence that N-glycans on the rat growth hormone led to its preferential secretion from the apical membrane of a polarized cell. This is in contrast with its random secretion from apical and basolateral membranes when in its normally unglycosylated form. Later work suggested that the N- and O-linked glycosylation of both transmembrane and GPI anchored proteins were important for their apical delivery in polarized cells (Yeaman et al., 1997
; Gut et al., 1998
; Benting et al., 1999
). Whether movement to the cell surface in nonpolarized cells or apical cell surface in polarized cells requires specific lectins to recognize the carbohydrate structures (Fiedler and Simons, 1995
), or whether carbohydrates alter a proteins structure into a transport competent form or expose a targeting signal (Rodriguez-Boulan and Gonzalez, 1999
) is not clear. Work from our laboratory suggests that the N158Q mutant of the ST6Gal I is most likely retained intracellularly in the Golgi because eliminating the oligosaccharide at this site allows increased oligomerization of the protein (Chen et al., 2000
). This is more consistent with the view of Rodriguez-Boulan and Gonzalez (1999)
that oligosaccharides play a secondary role in protein transport by influencing the tertiary or quaternary structure of a protein.
Using endo- and exoglycosidases, Fast et al. (1993)
tested the role of N-linked oligosaccharides in the activity of a purified form of the ST6Gal I. They found that removing the N-linked oligosaccharides from the enzyme with N-glycanase substantially decreased enzyme activity. Using exoglycosidases to remove sialic acid and galactose had little effect on catalytic activity, while removing GlcNAc residues decreased the activity to 3147% of the untreated enzyme. Since we observe that deglycosylated ST6Gal I is active in vivo, we speculate that that their enzymatically deglycosylated enzyme may have aggregated leading to a loss of in vitro enzyme activity. This possibility would reconcile these two sets of data; however, it would still not explain the partial loss of activity observed by these researchers upon the removal of terminal GlcNAc residues from the ST6Gal I oligosaccharides.
| Materials and methods |
|---|
|
|
|---|
Tissue culture media and reagents, including Dulbeccos modified Eagles medium (DMEM), Lipofectin and LipofectAMINE were purchased from Life Technologies, Inc. (Gaithersburg, MD). Fetal bovine serum was obtained from Atlanta Biologicals (Norcross, GA). Sequenase enzyme was obtained from U. S. Biochemical Corp. (Cleveland, OH). FITC-conjugated goat anti-rabbit IgG was purchased from EY laboratories (San Mateo, CA). FITC-conjugated Sambucus nigra agglutinin (SNA or elderberry bark lectin) was purchased from Vector Laboratories, Inc. (Burlingame, CA). Protein A Sepharose Fast Flow and CNBr-activated Sepharose 4 Fast Flow were purchased from Amersham Pharmacia Biotech, Inc. (Piscataway, NJ). Columns for DNA purification were obtained from Qiagen Inc. (Chatsworth, CA). Protein molecular weight standards were purchased from Bio-Rad (Richmond, CA). PNGase F was purchased from New England BioLabs (Beverly, MA). 35S-Express protein labeling mix and 14C-CMP-NeuAc were purchased from DuPont NEN (Boston, MA). QuikChange Site-Directed Mutagenesis Kit was purchased from Stratagene (La Jolla, CA). Asialofetuin and all other chemicals were purchased from Sigma (St. Louis, MO).
Construction of Asn mutants and soluble forms of the ST6Gal I
In vitro site-directed mutagenesis was done using QuikChange Site-Directed Mutagenesis Kit from Stratagene. The following oligonucleotides were used in the construction of the Asn mutants of STtyr. Primer 1, GAGACCATGTGAGCGTGTCTATGATA; primer 2, TATCATA GACACGCTCACATGGTC; primer 3, GATTTTCCCTTCCAGACGACTGAGTGGG; primer 4, CCCACTCAGTCGTCTGGAAGGGAAAATC. Primer 1 and 2 were used to synthesize N146S, primer 3 and 4 were used to synthesize N158Q. Mutating Asn 158 to Gln in the STtyr N146S mutant using primer 3 and 4 generated the N146S/N158Q double glycosylation mutant. Soluble forms of STtyr were generated as follows. Polymerase chain reaction (PCR) using Vent polymerase (New England BioLabs) was performed according to manufacturers instructions using STtyr wild type coding sequences or the Asn mutant N146S/N158Q coding sequence in pSVL as templates. The PCR fragments encoding the specific sequences of the ST proteins were gel-purified using low melting point agarose (Life Technologies, Inc.) and were then ligated into pcDNA3.1 vector containing a signal peptide immediately 5 prime of the ST coding sequences. Specific restriction enzyme sites were incorporated into the oligonucleotides used in the PCR reactions and allowed the ligation of DNA fragments into the expression vector. The following oligonucleotides were used in the PCR reaction. Primer 1, CTAGCTAGCAAGCAAGACCCT; primer 2, CTAGCTAGCTTCCAGGTGTGGGAC; primer 3, CTAGCTAGCTACTCAAAACTTAAC; primer 4, GCTCTAGACAACGAATGTTCCG. Primers 1 and 4 were used to synthesize the STtyr soluble form spWT1 and spD1 (spWT1-N146S/N158Q) consisting of amino acids 64403. Primers 2 and 4 were used to synthesize the STtyr soluble form spWT2 consisting of amino acids 89403. Primers 3 and 4 were used to synthesize the STtyr soluble form spWT3 or spD3 (spWT3-N146S/N158Q) consisting of amino acids 97403.
Transfection of COS and CHO cells
COS-1 cells maintained in DMEM, 10% fetal bovine serum or CHO cells maintained in
-MEM, 10% fetal bovine serum were plated on 100-mm tissue culture dishes and grown in a 37°C, 5% CO2 incubator until 5070% confluent. Cells were transfected using the Lipofectin (COS-1) or LipofectAMINE (CHO) and Opti-MEM I with 55 µM ß-mercaptoethanol according to the Life Technologies, Inc. instructions and as described previously (Colley et al., 1992
). Expression of transfected proteins was typically allowed to continue for 16 h.
Immunofluorescence localization and SNA lectin staining
COS-1 or CHO cells expressing wild-type STtyr, N146S, N158Q and N146S/N158Q mutants were processed for immunofluorescence microscopy as described previously (Colley et al., 1992
; Dahdal and Colley, 1993
; Ma et al., 1997
). Following the fixation and blocking steps, cells were incubated for 45 min with a 1:100 dilution of a rabbit affinity purified antibody raised against rat liver ST6Gal I (Ma et al., 1997
) in blocking buffer. Following PBS washes, a goat anti-rabbit secondary antibody conjugated to FITC and diluted 1:100 in blocking buffer was incubated with the cells. For staining transfected CHO cells with FITC-conjugated SNA lectin (Sambucus nigra agglutinin, elderberry bark lectin), the blocking step was eliminated and unpermeabilized cells were incubated with a 1:200 dilution of the FITC-conjugated SNA in PBS for 45 min. Washing and mounting was performed as previously described (Ma et al., 1997
). Immunofluorescence staining was visualized and photographed using a Nikon Axiophot microscope equipped with epifluorescence illumination and either a 20x Fluor 20 objective or a 60x oil immersion Plan Apochromat objective.
Pulse-chase analysis and immunoprecipitation of transiently expressed proteins
Metabolic labeling of cells and immunoprecipitation of expressed proteins was performed as previously described using 35S-Express protein labeling mix (100 µCi/ml) and methionine- and cysteine-free DMEM (Colley et al., 1992
; Dahdal and Colley, 1993
; Ma et al., 1997
). Cells were chased for various times in 4 ml of DMEM, 10% FBS and lysed in immunoprecipitation buffer (50 mM TrisHCl, pH 7.5, 150 mM NaCl, 5 mM EDTA, 0.5% Nonidet P-40, 0.1% SDS). Immunoprecipitation of expressed proteins were processed as described previously (Colley et al., 1992
; Dahdal and Colley, 1993
; Ma et al., 1997
). Immunoprecipitated proteins were denatured in Laemmli sample buffer with 5% ß-mercaptoethanol by boiling for 5 min. Immunoprecipitated proteins were analyzed using 10% SDSpolyacrylamide gels (Laemmli, 1970
) and radiolabeled proteins were visualized by fluorography and exposure to x-ray film. Prestained protein molecular markers (Bio-Rad) used in this study are 203 kDa, myosin; 113116 kDa, ß-galactosidase; 8288 kDa bovine serum albumin; 48.7 kDa, ovalbumin; 3335 kDa, carbonic anhydrase; 2829 kDa, soybean trypsin inhibitor; 21 kDa, lysozyme; and 8 kDa, aprotinin.
PNGase F digestions
COS cells transiently expressing STtyr and the Asn mutants were labeled for 1 h, as described above. ST proteins were immunoprecipitated from cell lysates. Immunoprecipitates were divided into two portions and treated with or without 1000 units of PNGase F in 10 mM TrisHCl, pH 7.2, 50 mM EDTA, pH 7.2, 0.2% SDS, 1% Nonidet P-40, and 20 mM ßmercaptoethanol (Masibay et al., 1993
). After incubation at 37°C for 16 h, samples were analyzed by SDSpolyacrylamide gel electrophoresis and fluorography.
Coupling of asialofetuin to Sepharose 4 Fast Flow beads
Coupling solution was prepared by dissolving 250 mg asialofetuin in 5 ml of 200 mM phosphate buffer, pH 8.0. CNBr-activated Sepharose 4 Fast Flow (2.2 g) was washed first with 1015 packed bead volumes of cold 1 mM HCl and then mixed with coupling solution. The mixture was rotated for 4 h at room temperature. After coupling, the solution was removed by vacuum. The mixture was washed with 10 ml of 200 mM phosphate buffer, pH 8.0, then with 10 ml of 200 mM TrisHCl, pH 7.5, and then was incubated in 200 mM TrisHCl, pH 7.5 for blocking overnight at 4°C. The mixture was then washed three times each with 1 packed bead volume of 100 mM TrisHCl buffer, pH 8.5 and 1 packed bead volume of 100 mM acetate buffer, pH 3.5. The cycle was repeated three or four times. The coupled beads were stored in 1 packed bead volume of 50 mM sodium cacodylate, pH 6.0 plus 20% ethanol.
Sialyltransferase assays
Assay mix containing CMP-[14C]NeuAc was made as described previously (Ma et al., 1997
). Asialofetuin coupled Sepharose 4 Fast Flow was washed three times in 1 packed bead volume of 50 mM sodium cacodylate, pH 6.0 and then was resuspended in 1 packed bead volume 50 mM sodium cacodylate, pH 6.0. Sialyltransferase assays were performed by mixing 60 µl of assay mix with 100 µl of asialofetuin coupled Sepharose 4 Fast Flow and with 100 µl of media or cell lysate from mock transfected COS-1 cells or COS-1 cells transiently expressing the wild-type STtyr, its glycosylation mutants and soluble forms. The mixture was rotated for 1 h at 37°C. Asialofetuin coupled Sepharose 4 Fast Flow was pelleted by centrifugation, the supernatant removed, and the beads were washed three times with 1 ml of 0.2M NaCl to remove free CMP-[14C]NeuAc. 14C-NeuAc transferred to the asialofetuin was counted by resuspending the asialofetuin coupled beads in 10 ml Bio-Safe II scintillation fluid (Research Products International Corp.) and counting the mixture in a Beckman LS 6500 scintillation counter. Picomoles of NeuAc transferred per hour per sample were calculated based on a specific activity of 6587 c.p.m./nmol.
Quantitation of protein to normalize the sialyltransferase assay results
One hundred microliters of media from COS-1 cells transiently expressing the wild-type, glycosylation mutants, and soluble forms of STtyr in serum-free DMEM media were denatured in Laemmli sample buffer with 5% ß-mercaptoethanol by boiling for 5 min. Proteins were analyzed using 10% SDSpolyacrylamide gels (Laemmli, 1970
). ST proteins were visualized by immunoblot analysis using an anti-ST antibody and chemiluminescent detection as described previously (Ma and Colley, 1996
). The films were scanned using Adobe Photoshop 4.0 program. Activities for each sample were standardized according to the band density reported using the ImageQuant Tools program.
| Acknowledgments |
|---|
|
|
|---|
We would like to thank Brett Close for his critical reading of the manuscript. This work was supported by National Institutes of Health Research Grant GM48134 (to K.C.). K.C. is an Established Investigator of the American Heart Association.
| Abbreviations |
|---|
|
|
|---|
DMEM, Dulbeccos modified Eagles medium; SNA, Sambucus nigra agglutinin; PNGase F, peptide N-glycosidase F; PCR, polymerase chain reaction; FBS, fetal bovine serum; FITC, fluorescein isothiocyanate; PBS, phosphate-buffered saline.
| Footnotes |
|---|
1 To whom correspondence should be addressed at: Department of Biochemistry and Molecular Biology, University of Illinois at Chicago College of Medicine, 1819 West Polk Street M/C 536, Chicago, IL 60612
| References |
|---|
|
|
|---|
Benting,J.H., Rietveld,A.G. and Simons,K. (1999) N-glycans mediate the apical sorting of a GPI-anchored, raft-associated protein in Madin-Darby canine kidney cells. J. Cell Biol., 146, 313320.
Chen,C., Ma,J., Lazic,A., Backovic,M. and Colley,K.J. (2000) Formation of insoluble oligomers correlates with ST6GalI stable localization in the Golgi. J. Biol. Chem., forthcoming.
Colley,K.J., Lee,E.U., Adler, B, Browne,J.K. and Paulson,J.C. (1989) Conversion of a Golgi apparatus sialyltransferase to a secretory protein by replacement of the NH2-terminal signal anchor with a signal peptide. J. Biol. Chem., 264, 1761917622.
Colley,K.J., Lee,E.U. and Paulson,J.C. (1992) The signal anchor and stem regions of the ß-galactoside
-2, 6-sialyltransferase may each act to localize the enzyme to the Golgi apparatus. J. Biol. Chem., 267, 77847793.
Dahdal,R.Y. and Colley,K.J. (1993) Specific sequences in the signal anchor of the ß-galactoside
-2,6-sialyltransferase are not essential for Golgi localization. J. Biol. Chem., 268, 2631026319.
Fast,D.G., Jamieson,J.C. and McCaffrey,G. (1993) The role of the carbohydrate chains of Galß-1,4-GlcNAc
2,6-sialyltransferase for enzyme activity. Biochim. Biophys. Acta, 1202, 325330.[Medline]
Fiedler,K. and Simons,K. (1995) The role of N-glycans in the secretory pathway. Cell, 81, 309312.[Web of Science][Medline]
Gastinel,L.N., Cambillau,C. and Bourne,Y. (1999) Crystal structures of the bovine ß4galactosyltransferase catalytic domain and its complex with uridine diphosphogalactose. EMBO J., 18, 35463557.[Web of Science][Medline]
Guan,J.-L. and Rose,J.K. (1984) Conversion of a secretory protein into a transmembrane protein results in its transport to the Golgi complex but not to the cell surface. Cell, 37, 779787.[Web of Science][Medline]
Guan,J.-L., Machamer,C.E. and Rose,J.K. (1985) Glycosylation allows cell-surface transport of an anchored secretory protein. Cell, 42, 489496.[Web of Science][Medline]
Gut,A., Kappeler,F., Hyka,N., Balda,M.S., Hauri,H.-P. and Matter,K. (1998) Carbohydrate-mediated Golgi to cell surface transport and apical targeting of membrane proteins. EMBO J., 17, 19191929.[Web of Science][Medline]
Haraguchi,M., Yamashiro,S., Furukawa,K., Takamiya,K., Shiku,H. and Furukawa,K. (1995) The effects of the site-directed removal of N-glycosylation sites from ß-1,4-N-acetylgalactosminyltransferase on its function. Biochem. J., 312, 273280.
Kitazume-Kawaguchi,S., Dohmae,N., Takio,K., Tsuji,S. and Colley,K.J. (1999) The relationship between ST6Gal I Golgi retention and its cleavage-secretion. Glycobiology, in press.
Kornfeld,S. and Kornfeld,R. (1985) Assembly of asparagine-linked oligosaccharides. Annu. Rev. Biochem., 54, 631664.[Web of Science][Medline]
Laemmli,U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680685.[Medline]
Lee,E.U., Roth,J. and Paulson,J.C. (1989) Alteration of terminal glycosylation sequences on N-linked oligosaccharides of Chinese hamster ovary cells by expression of ß-galactoside
2,6-sialyltransferase. J. Biol. Chem., 264, 1384813855.
Ma,J. and Colley,K.J. (1996) A disulfide-bonded dimer of the Golgi ß-galactoside
2, 6-sialyltransferase is catalytically inactive yet still retains the ability to bind galactose. J. Biol. Chem., 271, 77587766.
Ma,J., Qian,R., Rausa,F.M. and Colley,K.J. (1997) Two naturally occurring
2, 6-sialyltransferase forms with a single amino acid change in the catalytic domain differ in their catalytic activity and proteolytic processing. J. Biol. Chem., 272, 672679.
Maley,F., Trimble,R.B., Tarentino,A.L. and Plummer,T.H.,Jr. (1989) Characterization of glycoproteins and their associated oligosaccharides through the use of endoglycosidases. Anal. Biochem., 180, 195204.[Web of Science][Medline]
Martina,J.A., Daniotti,J.L. and Maccioni,H.J.F. (1998) Influence of N-glycosylation and N-glycan trimming on the activity and intracellular traffic of GD3 synthase. J. Biol. Chem., 273, 37253731.
Masibay,A.S., Balaji,P.J., Boeggeman,E.E. and Quasba,P.K. (1993) Mutational analysis of the Golgi retention signal of bovine ß1,4-galactosyltransferase. J. Biol. Chem., 268, 99089916.
Nagai,K., Ihara,Y., Wada,Y. and Taniguchi,N. (1997) N-Glycosylation is requisite for the enzyme activity and Golgi retention of N-acetylglucosyaminyltransferase III. Glycobiology, 7, 769776.
Rodriguez-Boulan,E. and Gonzalez,A. (1999) Glycans in post-Golgi apical targeting: sorting signals or structural props? Trends Cell Biol., 9, 291294.[Web of Science][Medline]
Scheiffele,P., Peranen,J. and Simons,K. (1995) N-glycans as apical sorting signals in epithelial cells. Nature, 378, 9698.[Medline]
Shibuya,N., Goldstein,I.J., Broekaert,W.F., Nsimba-Lubaki,M., Peeters,B. and Peumans,W.J. (1987) The elderberry (Sambucus nigra L.) bark lectin recognizes the Neu5Ac (
2-6)Gal/GalNAc sequence. J. Biol. Chem., 262, 15961601.
Toki,D., Sarkar,M., Yip,B., Reck,F. Joziasse,D., Fukuda,M., Schachter,H. and Brockhausen,I. (1997) Expression of stable human O-glycan core 2 ß-1,6-N-acetylglucosaminyltransferase in Sf9 insect cells. Biochem. J., 325, 6369.
Varki,A. (1993) Biological roles of oligosaccharides: all theories are correct. Glycobiology, 3, 97130.
Weinstein,J., Lee,E.U., McEntee,K., Lai,P.-H. and Paulson,J.C. (1987) Primary structure of ß-galactoside
2,6-sialyltransferase. J. Biol. Chem., 262, 1773517743.
Yeaman,C., Le Gall,A.H., Baldwin,A.N., Monlauzeur,L., Le Bivic,A. and Rodriguez-Boulan,E. (1997) The O-glycosylated stalk domain is required for apical sorting of neurotropin receptors in polarized MDCK cells. J. Cell Biol., 139, 929940.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
A. V. Woodard-Grice, A. C. McBrayer, J. K. Wakefield, Y. Zhuo, and S. L. Bellis Proteolytic Shedding of ST6Gal-I by BACE1 Regulates the Glycosylation and Function of {alpha}4{beta}1 Integrins J. Biol. Chem., September 26, 2008; 283(39): 26364 - 26373. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Uemura, T. Kurose, T. Suzuki, S. Yoshida, M. Ito, M. Saito, M. Horiuchi, F. Inagaki, Y. Igarashi, and J.-i. Inokuchi Substitution of the N-glycan function in glycosyltransferases by specific amino acids: ST3Gal-V as a model enzyme Glycobiology, March 1, 2006; 16(3): 258 - 270. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Vainauskas and A. K. Menon Endoplasmic Reticulum Localization of Gaa1 and PIG-T, Subunits of the Glycosylphosphatidylinositol Transamidase Complex J. Biol. Chem., April 22, 2005; 280(16): 16402 - 16409. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. R. Francis, L. Paquin, C. Weinkauf, and D. L. Jarvis Biosynthesis and processing of Spodoptera frugiperda{alpha}-mannosidase III Glycobiology, June 1, 2002; 12(6): 369 - 377. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. E. Close, J. M. Wilkinson, T. J. Bohrer, C. P. Goodwin, L. J. Broom, and K. J. Colley The polysialyltransferase ST8Sia II/STX: posttranslational processing and role of autopolysialylation in the polysialylation of neural cell adhesion molecule Glycobiology, November 1, 2001; 11(11): 997 - 1008. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Muhlenhoff, A. Manegold, M. Windfuhr, B. Gotza, and R. Gerardy-Schahn The Impact of N-Glycosylation on the Functions of Polysialyltransferases J. Biol. Chem., August 31, 2001; 276(36): 34066 - 34073. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Qian, C. Chen, and K. J. Colley Location and Mechanism of alpha 2,6-Sialyltransferase Dimer Formation. ROLE OF CYSTEINE RESIDUES IN ENZYME DIMERIZATION, LOCALIZATION, ACTIVITY, AND PROCESSING J. Biol. Chem., July 27, 2001; 276(31): 28641 - 28649. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





