Glycobiology, 2000, Vol. 10, No. 3 237-242
© 2000 Oxford University Press
Interaction between galectin-3 and Fc
RII induces down-regulation of IL-5 gene: implication of the promoter sequence IL-5REIII
Immunology Department, Fundación Jiménez Díaz, 28040 Madrid, Spain, 2Department of Experimental Immunology, Institute of Development, Aging and Cancer (IDAC), Tohoku University, Sendai 9808575, Japan, 3Department of Immunology, University of Utrecht, The Netherlands, and 4Division of Allergy, La Jolla Institute for Allergy and Immunology, San Diego CA 92121, USA
Received on June 1, 1999; revised on August 12, 1999; accepted on September 24, 1999.
| Abstract |
|---|
|
|
|---|
Our previous work demonstrated the capacity of galectin-3 (a ß-galactoside binding animal lectin) to inhibit IL-5 gene expression in different cell types, but the interaction of lectin with the cells and the pathways for the inhibition process are unknown. One of the purposes of this work was to study the cellular ligand for galectin-3. We have demonstrated that galectin-3 can bind to the low affinity IgG receptor (Fc
RII or CD32) by using different experimental approaches, such as flow cytometry, fusion protein GST technology, and with a model of Fc
RII-deficient mice. To further analyze the interaction between Fc
RII and galectin-3, and its implication in IL-5 gene down-regulation we used Fc
RII-deficient mice. When PBMC from these mice were incubated with galectin-3, the expression of the IL-5 gene was unchanged. However, when PBMC from wild type mice and Fc
RIII-deficient mice were incubated with galectin-3, IL-5 gene expression was down-regulated. Finally, we studied the implication of the negative regulatory sequence in the IL-5 gene promoter. In the presence of galectin-3, a DNA-protein complex was formed with the IL-5REIII region. This complex was not observed when unrelated oligonucleotide was used. So, galectin-3 induces a pathway, which activates a transcription factor that binds to IL-5REIII. This interaction is capable of inhibiting IL-5 gene transcription. Key words: allergy/Fc receptors/immunomodulators/regulatory elements/Th2 response
| Introduction |
|---|
|
|
|---|
Galectin-3 (Mr 31 kDa), is a lectin which binds to ß-galactoside residues in different glycoconjugates (Zuberi et al., 1994
Recently, we have described the property of galectin-3 to inhibit IL-5 gene expression and the protein secreted in several cellular systems: EoL-3 cell line, human eosinophils, T-cell line, and PBMC (peripheral blood mononuclear cells) from allergic patients (Cortegano et al., 1998
). The objectives of this work are to study the possible cellular ligand for galectin-3 and to determine the nuclear regulatory sequences involved in this process.
Galectin-3 does not contain a transmembrane domain, and for this reason it needs a ligand to anchor the cell surface. Several glycoprotein ligands for galectin-3 are probably present in different cell types (lymphocytes, endothelial cells, and macrophages) and some of them have been identified. For example, it is known that this protein binds both IgE and the high-affinity IgE receptor (Frigeri et al., 1993
). Although eosinophils express low levels of this IgE receptor, they express high levels of Fc
RII (CD32) (Koenderman et al., 1993
). For these reasons, we considered it to be a good candidate to interact with galectin-3.
In general, Fc
R has been reported to play an important role as a functional receptor in several immune processes, including degranulation, superoxide anion production, leukotriene production, and phagocytosis (Grover et al., 1978
). In order to demonstrate the interaction between galectin-3 and Fc
RII we used three different approaches: determination of the effect of galectin-3 on CD32 detection by flow cytometry, detection of binding of Fc
RII by GST-galectin-3 fusion protein, and demonstration of the lack of effect by galectin-3 on IL-5 mRNA expression in PBMC from Fc
RII-deficient mice. After applying these three different methods we reached the conclusion that galectin-3 binds to Fc
RII on cell surface.
Also, in this work the regulation of IL-5 gene at nuclear level and the regulatory sequences implicated in IL-5 gene inhibition by galectin-3 were studied. Using EMSA (electrophoretic mobility shift assay), we identified a sequence on the IL-5 promoter that contributes to the inhibitory response of galectin-3. Our results showed that in the presence of galectin-3, a DNAprotein complex is formed.
| Results |
|---|
|
|
|---|
Galectin-3 binds low affinity IgG receptor (Fc
RII): analysis by flow cytometryFlow cytometry analysis shows that when PBMC and eosinophils from allergic patients and EoL-3 cells are incubated with galectin-3 (10 µg/ml), levels of cell surface CD32 were reduced as compared with untreated cells. Figure 1 shows a representative experiment. Cells were treated with galectin-3 and stained with PE-CD32 monoclonal antibody. As negative control a monoclonal antibody with the same isotype was used. In all cases, CD32 detection decreases when cells were treated with galectin-3, although per cent differences were observed among different cell types: PBMC, 21 ± 8 versus 12 ± 2; eosinophils, 50 ± 15 versus 36 ± 18; and EoL-3 cells, 71 ± 24 versus 40 ± 32, n = 3.
|
In order to confirm that the effect observed using galectin-3 is CD32 specific, we used another antibody, anti-DR. The expression of surface receptors was not modified by galectin-3. For example, for PBMC, percent DR expression was 14.3 ± 7.3 before treatment and 11.1 ± 4.5 after incubation with galectin-3 (n = 3).
Galectin-3 binds low affinity IgG receptor (Fc
RII): analysis by GST-fusion protein system
In order to verify the flow cytometry results we used a GST-galectin-3 fusion protein to demonstrate the cellular ligand. Cell lysates (EoL-3 cell line and PBMC from allergic patients) were incubated with the fusion protein GST-galectin-3 as described in Material and methods. The results showed that GST-galectin-3 binds a protein of ~35 kDa as detectable by immunoblotting using anti-CD32 antibody (26 kDa for GST + 31 kDa for galectin-3 + 35 kDa for CD32) (Figure 2, panel A, lane 1). In the absence of galectin-3-GST, a band corresponding to the Fc
RII protein (35 kDa) was observed (lane 2). Incubation with GST alone gave negative results (lane 3).
|
Incubation of the same membranes with monoclonal anti-galectin-3 (positive control) revealed the same 90 kDa band and another protein of lower molecular weight (Figure 2, panel B). This second protein could correspond to a trace of galectin-3. Results from probing with anti-CD19 (non-related antibody) were negative in all cases (data not shown).
Effect of galectin-3 on IL-5 mRNA expression in different Fc
R-deficient mice
To analyze the biological effect of galectin-3 on IL-5 down-regulation and the implication of CD32 in vivo, we used PBMC from Fc
RII-deficient mice and compared the results with C57BL/6 (wild type) mice and Fc
RIII-deficient mice. Mice were treated with Al(OH)3 and PBMC were obtained after 5 days. IL-5 mRNA was demonstrated by RT-PCR in basal conditions in all mice.
In the case of Fc
RII-deficient mice, galectin-3 does not modify the IL-5 mRNA expression (Figure 3). In contrast, when cells from Fc
RIII-deficient mice, or wild type mice were incubated with galectin-3, the IL-5 transcripts were not detected. This effect is galectin-3-dependent because when cells were cultured with galectin-3 plus anti-galectin-3, IL-5 mRNA transcription was not altered. ß-actin PCR was performed as mRNA extraction control (lower panel). These results demonstrate that when the low affinity receptor for IgG (CD32) is present on the cellular surface, galectin-3 is able to inhibit IL-5 gene expression. In contrast, galectin-3 is unable to down-regulate the IL-5 gene in cells that lack this receptor.
|
The expression of IL-4 and
-IFN is not changed in the same experimental conditions (data not shown).
Galectin-3 induces transcription factor binding to the IL-5REIII oligonucleotide
As has been described, there is a negative regulator element in the promoter region of the IL-5 gene (IL-5REIII) (Stranick et al., 1997
) and, for this reason, we wanted to know if after galectin-3 treatment, any change is associated with this regulatory element.
To examine the IL-5REIII region of the human IL-5 gene promoter after stimulation with galectin-3 (10 µg/ml), EMSA assays were performed with 32P-labeled oligonucleotides and nuclear extracts prepared from EoL-3 cells. As shown in Figure 4, when EoL-3 cells were treated with galectin-3 (lane 2), a DNA-protein complex appeared. However, this complex is not present in untreated cells (lane 1) or when EoL-3 cells were treated with galectin-3 plus lactose (an inhibitor of galectin-3) (lane 3). When unlabeled oligonucleotide was present in hundred-fold excess, an inhibition of complex formation was observed (lane 4). As specificity control we used consensus-binding sequences for additional transcription factor protein (AP1). In this case, no complexes were observed (lane 5).
|
| Discussion |
|---|
|
|
|---|
Galectin-3 is an animal lectin that has been implicated in different processes including inflammation and allergic pathologies. In a previous work, we demonstrated that galectin-3 down-regulates IL-5 gene expression in different cell types. Also, other authors have suggested a role for galectin-3 as a negative growth regulator through interaction with glycosylated surface receptors (Bao and Hughes, 1999
Galectin-3 does not contain a transmembrane domain and needs another protein to be displayed on the cell surface. One possible candidate for galectin-3 ligand is Fc
RII, because this receptor contains two characteristics that are important for this interaction. One of them is that Fc
RII (CD32) is highly expressed in the cell types studied. For example, EoL-3 cells express little or no Fc
RI (CD64), but Fc
RII is highly expressed (90%) in unstimulated cells (Nambu et al., 1991
). The second reason is that this receptor is highly glycosylated (Brooks et al., 1989
) and is likely to contain galactose-containing oligosaccharides recognizable by galectin-3. We demonstrated galectin-3-Fc
RII interaction using different experimental approaches: flow cytometry, GST-fusion protein system and cultures of PBMC from Fc
RII-deficient mice with galectin-3.
Our flow cytometry results reveal a partial decrease in percent expression of CD32 on cells treated with galectin-3 in several cell systems. The lower Fc
RII expression is not due to low Fc
RII synthesis because galectin-3 is in contact with the cells for only 1 h, clearly insufficient time to modify the transcription and transduction of the Fc
RII gene. We consider that the effect of galectin-3 is due to this lectin binding to Fc
RII and, thus, inhibition of binding by the antibody. However, these experiments did not rule out a possible steric impediment caused by the binding of galectin-3 in another place close to the Fc
RII.
In order to confirm a direct interaction of galectin-3 with Fc
RII, we used GST-galectin-3 fusion protein. A complex (90 kDa) formed between GST-galectin-3 and Fc
RII was detected by immunoblotting. This complex was stained with anti-CD32 and anti-galectin-3 monoclonal antibody. Although the experiment was done in the presence of SDS the complex did not dissociate because the low concentration of SDS (0.1%) and because the experiment was performed under nondenaturing conditions.
Having demonstrated the interaction between these two molecules, we were interested in knowing if the biological effect of galectin-3, previously described by our group on IL-5 gene down-regulation, is a consequence of this interaction. First, we studied whether the effect of galectin-3 in mice is comparable with that described by us in humans. For this purpose, we treated mice with Al (OH)3 to induce a Th2 profile and tested IL-5 gene expression in the presence or absence of galectin-3. As shown in Figure 3, galectin-3 inhibits IL-5 mRNA expression in PBMC from wild type mice treated with Al (OH)3. In contrast, galectin-3 is unable to inhibit IL-5 gene transcription on PBMC from Fc
RII-deficient mice. These mice have a complete gene disruption and the expression of Fc
RII is completely abrogated as it was determined in our laboratory by RT-PCR. Similar to the human system, galectin-3 does not alter basal levels for IL-4 and IFN-
mRNA.
These results confirm our previous data about the interaction between Fc
RII and galectin-3, because when this receptor is not present on the cell surface, IL-5 gene regulation is not affected by galectin-3. This effect is Fc
RII (CD32) specific, because a receptor which belongs to the same family, such as Fc
RIII (CD16), is unable to interact with galectin-3. Our results do not rule out other ligands for galectin-3. For example, Mac-2-BP (Mac-2 binding protein), a new member of the superfamily defined by the macrophage scavenger receptor is a galectin-3 ligand (Koths et al., 1993
). Preliminary results obtained in our laboratory have shown that Mac-2BP neutralizes the effect of galectin-3 on IL-5 gene expression.
We investigated the possible regulatory sequences implicated in IL-5 gene inhibition by galectin-3. Expression of IL-5 gene is tightly regulated and highly tissue-specific, being expressed mainly in the Th2 subtype of T cells, mast cells, and eosinophils (Plaut et al., 1989
). The regulation of IL-5 mRNA is primarily at the transcription level and is likely to be controlled, to a large extent, by regulatory elements in the promoter region that can influence the transcription of the gene. The IL-5 gene has been cloned (Campbell et al., 1987
), but only limited information has been reported regarding specific regulatory sequences that function in the transcriptional control of human IL-5 gene expression. The work of Stranick et al. (1997)
using DNAse I footprinting and mobility shift assays with nuclear protein extracts from a human IL-5-producing T cell clone, demonstrated that the human IL-5 promoter contains multiple response elements that act as protein binding sites. These regions are IL-5REI (-79, -45), REII (-123, -92), and REIII (-170, -130). The RE-I and RE-II sites are critical for inducible IL-5 promoter activity, while the RE-III site functions as a negative regulatory element.
An interesting feature in this study is the finding that in nuclear extracts from EoL-3 cells incubated with galectin-3, there is a protein, which binds to the IL-5REIII sequence, and a DNA-protein complex appears. This complex is a consequence of the effect of galectin-3 on these cells because in basal conditions we were unable to detect the complex. These results indicate that galectin-3 mobilizes a transcription factor with capacity to bind to the IL-5REIII negative region promoter.
This is the first time that a direct effect of galectin-3 on the IL-5 gene promoter is demonstrated. This negative regulation has important relevance since the binding of galectin-3 to cell surface is through low affinity IgG receptor, emphasizing the role of this receptor in the regulation of asthmatic-eosinophilic inflammation. Until now, the main interaction described between galectin 3 and different cells in the allergic reactions, was through the IgE molecule (Robertson and Liu, 1991
; Truong et al., 1993
; Monteseirín et al., 1996
; Yamaoka et al., 1996
).
In conclusion, our data indicate that galectin-3, which downregulates IL-5 gene expression, interacts with Fc
RII on cell surface from different cell types. Furthermore, a nuclear transcription factor, which binds to the negative regulatory element in the IL-5 gene, is implicated in the effect of galectin-3 on IL-5 inhibition. Further research is needed to define the cytoplasmic cascade that occurs following galectin-3-Fc
RII interaction and nuclear factors implicated in the IL-5 regulation.
| Materials and methods |
|---|
|
|
|---|
Reagents
PGEX-galectin-3 with human galectin-3 cDNA cloned between BamHI and EcoRI sites in vector pGEX-5X-3 and monoclonal anti-galectin-3 antibody (BC210) were obtained as described in a previous report (Liu et al., 1996
Probes used in EMSA were: IL-5REIII oligonucleotide 5' GGGATTTTTATTAAAAGATAAAAGTAAATTTATTTTTT- 3' and AP1 Consensus Oligonucleotide: 5' CGCTTGATGAGTCAGCCGGAA 3' (Promega, Madison, WI).
Cells
Peripheral blood was obtained from allergic patients after informed consent and approval by the hospitals Ethical Committee and used for isolation of eosinophils and lymphocytes. The Allergy Department of Fundación Jiménez Díaz selected patients with extrinsic allergy. Eosinophils from allergic patients were purified following a negative immunoselection technique, using magnetic beads (Hansel et al., 1989
). PBMC from allergic patients were isolated by density sedimentation gradient (Nycomed Pharma, Oslo, Norway).
A human eosinophilic leukemia cell line (EoL-3) was a generous gift from Dr. R.G.Lynch (University of Iowa, Iowa City, IA).
Mice
Fc
RII-deficient mice were constructed by Dr. Takai, Department of Experimental Immunology, Institute of Development, Aging and Cancer (IDAC), Tohoku University, Japan (Toshiyuki et al., 1996
). C57BL/6-CD16 (Fc
RIII-deficient mice) gene disrupted mice (Hazenbos et al., 1996
) were constructed by Dr. Sjef Verbeek, Department of Immunology, University of Utrecht, The Netherlands. C57BL/6 wild type mice were used as control.
Flow cytometry
EoL-3 cell line, PBMC and human eosinophils from allergic patients were incubated in presence or absence of galectin-3 (10 µg/ml) for 1 h at 37°C and 5% CO2. These cells were cultured with anti-CD32-PE antibody (Caltag Laboratories, Burlingame, CA) or irrelevant isotype control mAb at 10 µg/ml. After 30 min, cells were washed and fixed with 1% paraformaldehyde. Cells were analyzed by FACs Elite-XL (Cultek). A nonrelated antibody, anti-DR (Caltag Laboratories, Burlingame, CA), was used as control.
Expression and purification of GST-galectin-3 fusion protein and binding reaction
E.coli supercompetent cells (Stratagene, La Jolla, CA) were transformed with pGEX-GST-galectin-3 vector (Sambrook et al., 1989). The transformed E.coli was lysed and the lysate was mixed with 0.5 ml of glutathioneSepharose 4B for 30 min at 4°C (Gene Fusion System of Pharmacia Biotech, Spain). After three washes with PBS at 4°C, the fusion protein was eluted by adding 1 ml of glutathione elution buffer (100 mM reduced glutathione (Sigma, Madrid, Spain) in sterile distilled water). As a control, we used E.coli supercompetent cells transformed with pGEX-GST vector.
Cells (EoL-3 cell line and PBMC from allergic patients) were lysed with 100 mM TrisHCl pH 7.5, 300 mM NaCl, 2% NP40, 1 mM PMSF, 0.7 µg/ml pepstatin A (Sigma, Spain) and 0.5 µg/ml leupeptin (Sigma, Spain). After centrifugation, 1 µg of GST-galectin-3 or GST alone was added to the lysates. After 2 h at 4°C, 20 µl of glutathione-Sepharose 4B beads were added, and the mixture incubated for 1 h at 4°C. Next, three washes were done with 20 mM HEPES, pH 7.5, 150 mM NaCl, 0.1% Triton X-100, 10% glycerol, and 10 mM Na4P2O7) and, finally, with cold PBS. Samples were eluted with buffer as described above.
Immunoblotting
The samples were electrophoresed on 15% polyacrylamide gels (0.1% SDS-PAGE) and transferred to nitrocellulose membrane (Bio-Rad) in the Trans-Blot cell apparatus (Bio-Rad). The membranes were incubated with mouse anti-CD32 monoclonal antibody (Lander Diagnostic, Madrid, Spain), mouse anti-CD19 (Lander Diagnostic, Madrid, Spain) or anti-galectin-3 antibody, and finally, goat anti-mouse (Fab') 2, labeled with peroxidase (Caltag Laboratories, Burlingame, CA) was added. Proteins were visualized with chemiluminescence reagents according to the manufacturers protocol (ECL, Amersham).
Cell cultures
Mice (C57BL/6; Fc
RII-deficient mice and Fc
RIII-deficient mice) were treated intraperitoneally with 20 µg of Al(OH)3 in order to induce a Th2 cytokine profile (Victoratos et al., 1997
). After 5 days blood was drawn and PBMC were purified by density gradient (Lympholyte-M, Cedarlane Laboratories). A total of 1 x 106 cells/ml were cultured in 24-well flat bottom plates (Nunc, Roskilde, Denmark) in RPMI 1640 medium (Life Technologies, Renfrewshire, Scotland) supplemented with sodium pyruvate (5 mM), L-glutamine (2 mM), penicillin (50 U/ml), streptomycin (50 µg/ml; Flow Laboratories, Irvine, Scotland), 2-ME (5 x 105 M; Sigma Chemical Co., St. Louis, MO), and 10% heat-inactivated fetal bovine serum (Life Technologies). Cells (1 x 106 cells/ml) were incubated alone, in the presence of galectin-3 (10 µg/ml) or with galectin-3 plus anti-galectin-3 monoclonal antibody (10 µg/ml) for 24 h.
RT-PCR
Total RNA was extracted from cells by the Rneasy mini protocol (Qiagen, Valencia, California, USA). An amount corresponding to 1 µg of RNA was converted to cDNA by the reverse transcriptase enzyme reaction (AMV transcriptase reverse, Promega, Madison, WI) in a total volume of 40 µl.
PCR was performed in a final volume of 50 µl containing 710 µl of RT reaction product. ß-actin, IL-5, IL-4, and IFN-
(Clontech Laboratories, Palo Alto, CA) were amplified following the manufacturers instructions. A 20-µl aliquot from each PCR reaction was electrophoresed in a 1.5% agarose gel containing 0.5% ethidium bromide. The gel was then photographed under UV transillumination.
Preparation of nuclear extracts
Nuclear extracts were prepared from 1 x 107 EoL-3 as described previously (Dignam et al., 1983
). Cells were incubated with galectin-3 (10 µg/ml), or with galectin-3 plus lactose (50 mM). The protein content of the nuclear extracts was determined by the method of BCA (Protein Assay Reagent, Pierce, IL).
Electrophoretic mobility shift assays
Complementary oligonucleotide pair corresponding to human IL-5 region, IL-5REIII (Stranick et al., 1997
), was synthesized (Progenetic, Madrid, Spain), annealed, and 32P-labeled with [
32P] ATP (3000 Ci/mmol at 10 Ci/mmol) using T4 polynucleotide kinase (510 U/µl) from Promega (Madison, WI).
A total of 10 µl EMSA binding reactions containing 10 µg of total nuclear protein in binding buffer (Promega, Madison, WI) were incubated with 50,000100,000 cpm of 32P-labeled oligonucleotides (IL-5REIII or AP1) for 20 min at room temperature. Protein-DNA binding specificity was tested by competition assays in which the binding reaction was preincubated for 30 min at room temperature with excess unlabeled IL-5REIII oligonucleotide. Protein-DNA complexes were resolved by electrophoresis in 6% acrylamide gel in nondenaturing conditions.
| Acknowledgments |
|---|
|
|
|---|
We are indebted to Ms. Paloma Tramón for her help and technical assistance. This work was supported by a grant from FIS (Fondo de Investigaciones Sanitarias, 97/0104-TVI). I.C. and M.R. are recipients of a fellowship from the Fundación "Conchita Rábago" of Fundación Jiménez Díaz and S.G. from the Fondo de Investigaciones Sanitarias. I.A. is recipient of a fellowship from Fundación Lair, Madrid, Spain.
| Footnotes |
|---|
1 To whom correspondence should be addressed
| References |
|---|
|
|
|---|
Bao,Q. and Hughes,C. (1999) Galectin-3 and polarized growth within collagen gels of wild-type and ricin-resistant MDCK renal epithelial cells. Glycobiology, 9, 489495.
Brooks,D.G., Qiu,W.Q., Luster,A.D. and Ravetch,J.V. (1989) Structure and expression of human IgG FcRII (CD32). Functional heterogeneity is encoded by the alternatively spliced products of multiple genes. J. Exp. Med., 170, 13691385.
Campbell,H.D., Tucker,W.J., Hort,Y., Martison,M.E., Mayo,G., Clutterbuck,E.J., Sanderson,C.J. and Young,I.G. (1987) Molecular cloning, nucleotide sequence and expression of the gene encoding human eosinophil differentiation factor (interleukin-5). Proc. Natl. Acad. Sci. USA, 84, 66296633.
Cortegano,I., del Pozo,V., Cárdaba,B., de Andrés,B., Gallardo,S., del Amo,A., Arrieta,I., Jurado,A., Palomino,P., Liu,F-T. and Lahoz,C. (1998) Galectin-3 down-regulates IL-5 gene expression on different cell types. J. Immunol., 161, 354359.
Dignam,J.D., Lebovitz,R.M. and Roeder.R.G. (1983) Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res., 11, 14751489.
Frigeri,L.G. and Liu,F.-T. (1992) Surface expression of functional IgE binding protein, an endogenous lectin, on mast cells and macrophages. J. Immunol., 148, 861867.[Abstract]
Frigeri,L.G., Zuberi,R.I. and Liu,F-T. (1993)
BP, a ß-Galactoside-binding animal lectin, recognizes IgE receptor (Fc
RI) and activates mast cells. Biochemistry, 32, 76447649.[Medline]
Gritzmacher,C.A., Robertson,M. and Liu,F.-T. (1988) IgE binding protein: subcellular location and gene expression in many murine tissues and cells. J. Immunol., 141, 28012806.[Abstract]
Grover,W.H., Winkler,H.H. and Normasell,D.E. (1978) Phagocytic properties of isolated human eosinophils. J. Immunol., 121, 718725.
Hansel,T.T., Pound,J.D., Pilling,D., Kitas,G.D., Salmon,M., Gentle,T.A., Lee,S.S. and Thopson,R.A. (1989) Purification of human blood eosinophil by negative selection using immunomagnetic beads. J. Immunol. Methods, 122, 97103.[Web of Science][Medline]
Hazenbos,W.L., Gessner,J.E., Hofhuis,F.M., Kuipers,H., Meyer,D., Heijnen,A.F., Schmidt,R.E., Sandor,M., Capel,P.J., Däeron,M., Winkel,J.G. and Verbeek,J.S. (1996) Impaired IgG-dependent anaphylaxis and Arthus reaction in Fc
RIII (CD16) deficient mice. Immunity, 5, 181188.[Web of Science][Medline]
Koenderman,L., Hermans,S.W., Capel,P.J. and Winkel,J.G. (1993) Granulocyte-macrophage colony-stimulating factor induces sequential activation and deactivation of binding via a low-affinity IgG Fc receptor, hFc gamma RII, on eosinophils. Blood, 81, 24132419.
Koths,K., Taylor,E., Halenbeck,R., Casipit,C. and Wang,A. (1993) Cloning and characterization of a human Mac-2-binding protein, a new member of the superfamily defined by the macrophage scavenger receptor cysteine-rich domain. J. Biol. Chem., 268, 1424514249.
Liu,F-T. (1990) Molecular biology of IgE-binding protein, IgE-binding factors and IgE receptors. Crit. Rev. Immunol., 10, 289306.[Web of Science][Medline]
Liu,F-T., Hsu,D., Zuberi,R., Hill,P., Shenhav,A., Kuwabara,I. and Chen,S.S. (1996) Modulation of functional properties of galectin-3 by monoclonal antibodies binding to the non-lectin domains. Biochemistry, 35, 60736079.[Medline]
Monteseirín,J., Camacho,M.J., Montaño,R., Llamas,E., Conde,M., Carballo,M., Guardia,P., Conde,J. and Sobrino,F. (1996) Enhancement of antigen-specific functional responses by neutrophils from allergic patients. J. Exp. Med., 183, 25712579.
Moutsatsos,I.K., Wade,M., Schindler,M. and Wang,JL. (1987) Endogenous lectins from cultured cells: nuclear localization of carbohydrate-binding protein 35 in proliferating 3T3 fibroblasts. Proc. Natl. Acad. Sci. USA, 84, 64526456.
Nambu,M., Watanbe,H., Kim,K.M., Tanaka,M., Mayumi,M. and Mikawa,H. (1991) Regulation of Fc
receptor subtype expression on a human eosinophilic leukemia cell line EoL-3: participation of cAMP and protein kinase C in the effects of interferon-
and phorbol ester. Cell. Immunol., 133, 2740.[Web of Science][Medline]
Plaut,M., Pierce,J.H., Watson,C.J., Hanley-Hyde,J., Nordan,R.P. and Paul,W.E. (1989) Mast cell lines produce lymphokines in response to cross-linkage of Fc
IR or to calcium ionophores. Nature, 339, 6467.[Medline]
Robertson,M.W. and Liu, F-T. (1991) Heterogeneous IgE glycoforms characterized by differential recognition of an endogenous lectin (IgE-binding protein). J. Immunol., 147, 30243029.[Abstract]
Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 7481.
Sato,S. and Hughes,R.C. (1994) Regulation of secretion and surface expression of Mac-2, a galactoside-binding protein of macrophages. J. Biol. Chem., 269, 44244430.
Stranick,K.S., Zambas,D.N., Schettino-Uss,A., Egan,R.W., Billah,M.M. and Umland,S.P. (1997) Identification of transcription factor binding sites important in the regulation of the human interleukin-5 gene. J. Biol. Chem., 26, 1645316465.
Toshiyuki,T., Ono,M., Hikida,M., Ohmori,H. and Ravetch,J.V. (1996) Augmented humoral and anaphylactic responses in Fc
RII-deficient mice. Nature, 379, 346349.[Medline]
Truong,M-J., Gruart,M., Liu,F-T., Prin,L., Capron,A. and Capron,M. (1993). IgE-binding molecules (Mac-2/
BP) expressed by human eosinophils. Implication in IgE-dependent eosinophil cytotoxicity. Eur. J. Immunol., 23, 32303235.[Web of Science][Medline]
Victoratos,M., Yiangou,M., Avramidis,N. and Hadjipetrou,L. (1997) Regulation of cytokine gene expression by adjuvants in vivo. Clin. Exp. Immunol., 109, 569578.[Web of Science][Medline]
Yamaoka,K.A., Arock,M., Issaly,F., Dugas,N., Le Goff,L. and Kolb,J.P. (1996) Granulocyte macrophage colony stimulating factor induces Fc epsilon RII/CD23 expression on normal human polymorphonuclear neutrophils. Int. Immunol., 8, 479490.
Zuberi,R., Frigeri,L.G. and Liu,F-T. (1994). Activation of rat basophilic leukemia cells by epsilon BP, an IgE-binding endogenous lectin. Cell Immunol., 156, 112.[Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
C. Saravanan, Z. Cao, S. R. Head, and N. Panjwani Detection of Differentially Expressed Wound-Healing-Related Glycogenes in Galectin-3-Deficient Mice Invest. Ophthalmol. Vis. Sci., December 1, 2009; 50(12): 5690 - 5696. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. L. Oliveira, P. Frazao, R. Chammas, D. K. Hsu, F. T. Liu, R. Borojevic, C. M. Takiya, and M. C. El-Cheikh Kinetics of mobilization and differentiation of lymphohematopoietic cells during experimental murine schistosomiasis in galectin-3 / mice J. Leukoc. Biol., August 1, 2007; 82(2): 300 - 310. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Lopez, V. del Pozo, T. Miguel, B. Sastre, C. Seoane, E. Civantos, E. Llanes, M. L. Baeza, P. Palomino, B. Cardaba, et al. Inhibition of Chronic Airway Inflammation and Remodeling by Galectin-3 Gene Therapy in a Murine Model J. Immunol., February 1, 2006; 176(3): 1943 - 1950. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. V. Acosta-Rodriguez, C. L. Montes, C. C. Motran, E. I. Zuniga, F.-T. Liu, G. A. Rabinovich, and A. Gruppi Galectin-3 Mediates IL-4-Induced Survival and Differentiation of B Cells: Functional Cross-Talk and Implications during Trypanosoma cruzi Infection J. Immunol., January 1, 2004; 172(1): 493 - 502. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. del Pozo, M. Rojo, M. L. Rubio, I. Cortegano, B. Cardaba, S. Gallardo, M. Ortega, E. Civantos, E. Lopez, C. Martin-Mosquero, et al. Gene Therapy with Galectin-3 Inhibits Bronchial Obstruction and Inflammation in Antigen-challenged Rats through Interleukin-5 Gene Downregulation Am. J. Respir. Crit. Care Med., September 1, 2002; 166(5): 732 - 737. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Rabinovich, N. Rubinstein, and L. Fainboim Unlocking the secrets of galectins: a challenge at the frontier of glyco-immunology J. Leukoc. Biol., May 1, 2002; 71(5): 741 - 752. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||







