Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (25)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Cortegano, I.
Right arrow Articles by Lahoz, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cortegano, I.
Right arrow Articles by Lahoz, C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Glycobiology, 2000, Vol. 10, No. 3 237-242
© 2000 Oxford University Press

Interaction between galectin-3 and Fc{gamma}RII induces down-regulation of IL-5 gene: implication of the promoter sequence IL-5REIII

Isabel Cortegano, Victoria del Pozo, Blanca Cárdaba, Ignacio Arrieta, Soledad Gallardo, Marta Rojo, Esther Aceituno, Toshiyuki Takai2, Sjef Verbeek3, Pilar Palomino, Fu- Tong Liu4 and Carlos Lahoz1

Immunology Department, Fundación Jiménez Díaz, 28040 Madrid, Spain, 2Department of Experimental Immunology, Institute of Development, Aging and Cancer (IDAC), Tohoku University, Sendai 980–8575, Japan, 3Department of Immunology, University of Utrecht, The Netherlands, and 4Division of Allergy, La Jolla Institute for Allergy and Immunology, San Diego CA 92121, USA

Received on June 1, 1999; revised on August 12, 1999; accepted on September 24, 1999.


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
Our previous work demonstrated the capacity of galectin-3 (a ß-galactoside binding animal lectin) to inhibit IL-5 gene expression in different cell types, but the interaction of lectin with the cells and the pathways for the inhibition process are unknown. One of the purposes of this work was to study the cellular ligand for galectin-3. We have demonstrated that galectin-3 can bind to the low affinity IgG receptor (Fc{gamma}RII or CD32) by using different experimental approaches, such as flow cytometry, fusion protein GST technology, and with a model of Fc{gamma}RII-deficient mice. To further analyze the interaction between Fc{gamma}RII and galectin-3, and its implication in IL-5 gene down-regulation we used Fc{gamma}RII-deficient mice. When PBMC from these mice were incubated with galectin-3, the expression of the IL-5 gene was unchanged. However, when PBMC from wild type mice and Fc{gamma}RIII-deficient mice were incubated with galectin-3, IL-5 gene expression was down-regulated. Finally, we studied the implication of the negative regulatory sequence in the IL-5 gene promoter. In the presence of galectin-3, a DNA-protein complex was formed with the IL-5REIII region. This complex was not observed when unrelated oligonucleotide was used. So, galectin-3 induces a pathway, which activates a transcription factor that binds to IL-5REIII. This interaction is capable of inhibiting IL-5 gene transcription.

Key words: allergy/Fc receptors/immunomodulators/regulatory elements/Th2 response


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
Galectin-3 (Mr 31 kDa), is a lectin which binds to ß-galactoside residues in different glycoconjugates (Zuberi et al., 1994Go). This protein is composed of a small N-terminal domain, a region consisting of proline and glycine rich tandem repeats and a C-terminal carbohydrate-recognition domain (Liu, 1990Go). Galectin-3 is expressed in a variety of tissues and cell types (Gritzmacher et al., 1988Go). This protein is localized mainly in the cytoplasm, although a significant amount of this lectin can also be detected in the nucleus (Moutsatsos et al., 1987Go), on the cell surface (Frigeri and Liu, 1992Go), or in the extracellular environment (Sato and Hughes, 1994Go).

Recently, we have described the property of galectin-3 to inhibit IL-5 gene expression and the protein secreted in several cellular systems: EoL-3 cell line, human eosinophils, T-cell line, and PBMC (peripheral blood mononuclear cells) from allergic patients (Cortegano et al., 1998Go). The objectives of this work are to study the possible cellular ligand for galectin-3 and to determine the nuclear regulatory sequences involved in this process.

Galectin-3 does not contain a transmembrane domain, and for this reason it needs a ligand to anchor the cell surface. Several glycoprotein ligands for galectin-3 are probably present in different cell types (lymphocytes, endothelial cells, and macrophages) and some of them have been identified. For example, it is known that this protein binds both IgE and the high-affinity IgE receptor (Frigeri et al., 1993Go). Although eosinophils express low levels of this IgE receptor, they express high levels of Fc{gamma}RII (CD32) (Koenderman et al., 1993Go). For these reasons, we considered it to be a good candidate to interact with galectin-3.

In general, Fc{gamma}R has been reported to play an important role as a functional receptor in several immune processes, including degranulation, superoxide anion production, leukotriene production, and phagocytosis (Grover et al., 1978Go). In order to demonstrate the interaction between galectin-3 and Fc{gamma}RII we used three different approaches: determination of the effect of galectin-3 on CD32 detection by flow cytometry, detection of binding of Fc{gamma}RII by GST-galectin-3 fusion protein, and demonstration of the lack of effect by galectin-3 on IL-5 mRNA expression in PBMC from Fc{gamma}RII-deficient mice. After applying these three different methods we reached the conclusion that galectin-3 binds to Fc{gamma}RII on cell surface.

Also, in this work the regulation of IL-5 gene at nuclear level and the regulatory sequences implicated in IL-5 gene inhibition by galectin-3 were studied. Using EMSA (electrophoretic mobility shift assay), we identified a sequence on the IL-5 promoter that contributes to the inhibitory response of galectin-3. Our results showed that in the presence of galectin-3, a DNA–protein complex is formed.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
Galectin-3 binds low affinity IgG receptor (Fc{gamma}RII): analysis by flow cytometry
Flow cytometry analysis shows that when PBMC and eosinophils from allergic patients and EoL-3 cells are incubated with galectin-3 (10 µg/ml), levels of cell surface CD32 were reduced as compared with untreated cells. Figure 1 shows a representative experiment. Cells were treated with galectin-3 and stained with PE-CD32 monoclonal antibody. As negative control a monoclonal antibody with the same isotype was used. In all cases, CD32 detection decreases when cells were treated with galectin-3, although per cent differences were observed among different cell types: PBMC, 21 ± 8 versus 12 ± 2; eosinophils, 50 ± 15 versus 36 ± 18; and EoL-3 cells, 71 ± 24 versus 40 ± 32, n = 3.



View larger version (35K):
[in this window]
[in a new window]
 
Fig. 1. CD32 expression by flow cytometry on PBMC from an allergic patient, human eosinophils and EoL-3 cell line in cultures treated or not with galectin-3. Also, controls of cells incubated with antibodies of the same isotype are shown.

 
In order to confirm that the effect observed using galectin-3 is CD32 specific, we used another antibody, anti-DR. The expression of surface receptors was not modified by galectin-3. For example, for PBMC, percent DR expression was 14.3 ± 7.3 before treatment and 11.1 ± 4.5 after incubation with galectin-3 (n = 3).

Galectin-3 binds low affinity IgG receptor (Fc{gamma}RII): analysis by GST-fusion protein system
In order to verify the flow cytometry results we used a GST-galectin-3 fusion protein to demonstrate the cellular ligand. Cell lysates (EoL-3 cell line and PBMC from allergic patients) were incubated with the fusion protein GST-galectin-3 as described in Material and methods. The results showed that GST-galectin-3 binds a protein of ~35 kDa as detectable by immunoblotting using anti-CD32 antibody (26 kDa for GST + 31 kDa for galectin-3 + 35 kDa for CD32) (Figure 2, panel A, lane 1). In the absence of galectin-3-GST, a band corresponding to the Fc{gamma}RII protein (35 kDa) was observed (lane 2). Incubation with GST alone gave negative results (lane 3).



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 2. Galectin-3 binds to the Fc{gamma}RII. (A) Fusion protein GST-galectin-3 was incubated with EoL-3 cell line or PBMC extracts. After SDS-PAGE and immunoblot the membranes were stained with anti-CD32 antibody. Lane 1, Cell extract incubated with GST-galectin-3 fusion protein; lane 2, cellular extract untreated with fusion protein; and lane 3, cell lysate incubated with GST protein alone. (B) Immunoblot stained with anti-galectin-3 antibody. Lanes 1, 2, and 3 correspond to the same experiments described for (A). Protein bands were visualized using an HPRO labeled goat anti-mouse (Fab'2) immunoglobulins and developed by ECL system.

 
Incubation of the same membranes with monoclonal anti-galectin-3 (positive control) revealed the same 90 kDa band and another protein of lower molecular weight (Figure 2, panel B). This second protein could correspond to a trace of galectin-3. Results from probing with anti-CD19 (non-related antibody) were negative in all cases (data not shown).

Effect of galectin-3 on IL-5 mRNA expression in different Fc{gamma}R-deficient mice
To analyze the biological effect of galectin-3 on IL-5 down-regulation and the implication of CD32 in vivo, we used PBMC from Fc{gamma}RII-deficient mice and compared the results with C57BL/6 (wild type) mice and Fc{gamma}RIII-deficient mice. Mice were treated with Al(OH)3 and PBMC were obtained after 5 days. IL-5 mRNA was demonstrated by RT-PCR in basal conditions in all mice.

In the case of Fc{gamma}RII-deficient mice, galectin-3 does not modify the IL-5 mRNA expression (Figure 3). In contrast, when cells from Fc{gamma}RIII-deficient mice, or wild type mice were incubated with galectin-3, the IL-5 transcripts were not detected. This effect is galectin-3-dependent because when cells were cultured with galectin-3 plus anti-galectin-3, IL-5 mRNA transcription was not altered. ß-actin PCR was performed as mRNA extraction control (lower panel). These results demonstrate that when the low affinity receptor for IgG (CD32) is present on the cellular surface, galectin-3 is able to inhibit IL-5 gene expression. In contrast, galectin-3 is unable to down-regulate the IL-5 gene in cells that lack this receptor.



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 3. Effect of galectin-3 on mRNA IL-5 gene expression. RT-PCR cDNA conditions are described in Material and methods. IL-5 (upper panel) mRNA expression in PBMC from different mice: Fc{gamma}RII-deficient mice, wild type mice and Fc{gamma}RIII-deficient mice. Mice were treated with Al(OH)3 and PBMC were incubated or not with galectin-3 and with galectin-3 plus anti-galectin-3 for 24 h. C+ and C- are the positive and negative controls provided by the manufacturer. ß-actin RT-PCR was used as the mRNA extraction control (lower panel).

 
The expression of IL-4 and {gamma}-IFN is not changed in the same experimental conditions (data not shown).

Galectin-3 induces transcription factor binding to the IL-5REIII oligonucleotide
As has been described, there is a negative regulator element in the promoter region of the IL-5 gene (IL-5REIII) (Stranick et al., 1997Go) and, for this reason, we wanted to know if after galectin-3 treatment, any change is associated with this regulatory element.

To examine the IL-5REIII region of the human IL-5 gene promoter after stimulation with galectin-3 (10 µg/ml), EMSA assays were performed with 32P-labeled oligonucleotides and nuclear extracts prepared from EoL-3 cells. As shown in Figure 4, when EoL-3 cells were treated with galectin-3 (lane 2), a DNA-protein complex appeared. However, this complex is not present in untreated cells (lane 1) or when EoL-3 cells were treated with galectin-3 plus lactose (an inhibitor of galectin-3) (lane 3). When unlabeled oligonucleotide was present in hundred-fold excess, an inhibition of complex formation was observed (lane 4). As specificity control we used consensus-binding sequences for additional transcription factor protein (AP1). In this case, no complexes were observed (lane 5).



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 4. Electrophoretic mobility shift assay (EMSA) with EoL-3 cell nuclear extracts and oligonucleotide probe for IL-5REIII of the IL-5 promoter. EMSA was performed as described in Materials and methods. A total of 5 µg of protein was used in each lane for all binding assays. Nuclear protein extracts were prepared from unstimulated cells (lane 1), or cells stimulated with galectin-3 (lane 2), or galectin-3 plus lactose (lane 3) as described in Material and methods. The unlabeled competitor oligonucleotide was added at 100-fold molar excess (lane 4). AP1 sequence was used as not related oligonucleotide (lane 5). Control without protein extract was negative. The complex produced is indicated by an arrow. The free probe is shown at the bottom of each lane.

 

    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
Galectin-3 is an animal lectin that has been implicated in different processes including inflammation and allergic pathologies. In a previous work, we demonstrated that galectin-3 down-regulates IL-5 gene expression in different cell types. Also, other authors have suggested a role for galectin-3 as a negative growth regulator through interaction with glycosylated surface receptors (Bao and Hughes, 1999Go). In our case, the interaction and mechanisms involved were unknown. For this reason, we have first investigated the ligand of galectin-3 and afterwards the nuclear regulatory sequence involved in IL-5 gene inhibition after galectin-3-ligand interaction.

Galectin-3 does not contain a transmembrane domain and needs another protein to be displayed on the cell surface. One possible candidate for galectin-3 ligand is Fc{gamma}RII, because this receptor contains two characteristics that are important for this interaction. One of them is that Fc{gamma}RII (CD32) is highly expressed in the cell types studied. For example, EoL-3 cells express little or no Fc{gamma}RI (CD64), but Fc{gamma}RII is highly expressed (90%) in unstimulated cells (Nambu et al., 1991Go). The second reason is that this receptor is highly glycosylated (Brooks et al., 1989Go) and is likely to contain galactose-containing oligosaccharides recognizable by galectin-3. We demonstrated galectin-3-Fc{gamma}RII interaction using different experimental approaches: flow cytometry, GST-fusion protein system and cultures of PBMC from Fc{gamma}RII-deficient mice with galectin-3.

Our flow cytometry results reveal a partial decrease in percent expression of CD32 on cells treated with galectin-3 in several cell systems. The lower Fc{gamma}RII expression is not due to low Fc{gamma}RII synthesis because galectin-3 is in contact with the cells for only 1 h, clearly insufficient time to modify the transcription and transduction of the Fc{gamma}RII gene. We consider that the effect of galectin-3 is due to this lectin binding to Fc{gamma}RII and, thus, inhibition of binding by the antibody. However, these experiments did not rule out a possible steric impediment caused by the binding of galectin-3 in another place close to the Fc{gamma}RII.

In order to confirm a direct interaction of galectin-3 with Fc{gamma}RII, we used GST-galectin-3 fusion protein. A complex (90 kDa) formed between GST-galectin-3 and Fc{gamma}RII was detected by immunoblotting. This complex was stained with anti-CD32 and anti-galectin-3 monoclonal antibody. Although the experiment was done in the presence of SDS the complex did not dissociate because the low concentration of SDS (0.1%) and because the experiment was performed under nondenaturing conditions.

Having demonstrated the interaction between these two molecules, we were interested in knowing if the biological effect of galectin-3, previously described by our group on IL-5 gene down-regulation, is a consequence of this interaction. First, we studied whether the effect of galectin-3 in mice is comparable with that described by us in humans. For this purpose, we treated mice with Al (OH)3 to induce a Th2 profile and tested IL-5 gene expression in the presence or absence of galectin-3. As shown in Figure 3, galectin-3 inhibits IL-5 mRNA expression in PBMC from wild type mice treated with Al (OH)3. In contrast, galectin-3 is unable to inhibit IL-5 gene transcription on PBMC from Fc{gamma}RII-deficient mice. These mice have a complete gene disruption and the expression of Fc{gamma}RII is completely abrogated as it was determined in our laboratory by RT-PCR. Similar to the human system, galectin-3 does not alter basal levels for IL-4 and IFN-{gamma} mRNA.

These results confirm our previous data about the interaction between Fc{gamma}RII and galectin-3, because when this receptor is not present on the cell surface, IL-5 gene regulation is not affected by galectin-3. This effect is Fc{gamma}RII (CD32) specific, because a receptor which belongs to the same family, such as Fc{gamma}RIII (CD16), is unable to interact with galectin-3. Our results do not rule out other ligands for galectin-3. For example, Mac-2-BP (Mac-2 binding protein), a new member of the superfamily defined by the macrophage scavenger receptor is a galectin-3 ligand (Koths et al., 1993Go). Preliminary results obtained in our laboratory have shown that Mac-2BP neutralizes the effect of galectin-3 on IL-5 gene expression.

We investigated the possible regulatory sequences implicated in IL-5 gene inhibition by galectin-3. Expression of IL-5 gene is tightly regulated and highly tissue-specific, being expressed mainly in the Th2 subtype of T cells, mast cells, and eosinophils (Plaut et al., 1989Go). The regulation of IL-5 mRNA is primarily at the transcription level and is likely to be controlled, to a large extent, by regulatory elements in the promoter region that can influence the transcription of the gene. The IL-5 gene has been cloned (Campbell et al., 1987Go), but only limited information has been reported regarding specific regulatory sequences that function in the transcriptional control of human IL-5 gene expression. The work of Stranick et al. (1997)Go using DNAse I footprinting and mobility shift assays with nuclear protein extracts from a human IL-5-producing T cell clone, demonstrated that the human IL-5 promoter contains multiple response elements that act as protein binding sites. These regions are IL-5REI (-79, -45), REII (-123, -92), and REIII (-170, -130). The RE-I and RE-II sites are critical for inducible IL-5 promoter activity, while the RE-III site functions as a negative regulatory element.

An interesting feature in this study is the finding that in nuclear extracts from EoL-3 cells incubated with galectin-3, there is a protein, which binds to the IL-5REIII sequence, and a DNA-protein complex appears. This complex is a consequence of the effect of galectin-3 on these cells because in basal conditions we were unable to detect the complex. These results indicate that galectin-3 mobilizes a transcription factor with capacity to bind to the IL-5REIII negative region promoter.

This is the first time that a direct effect of galectin-3 on the IL-5 gene promoter is demonstrated. This negative regulation has important relevance since the binding of galectin-3 to cell surface is through low affinity IgG receptor, emphasizing the role of this receptor in the regulation of asthmatic-eosinophilic inflammation. Until now, the main interaction described between galectin 3 and different cells in the allergic reactions, was through the IgE molecule (Robertson and Liu, 1991Go; Truong et al., 1993Go; Monteseirín et al., 1996Go; Yamaoka et al., 1996Go).

In conclusion, our data indicate that galectin-3, which downregulates IL-5 gene expression, interacts with Fc{gamma}RII on cell surface from different cell types. Furthermore, a nuclear transcription factor, which binds to the negative regulatory element in the IL-5 gene, is implicated in the effect of galectin-3 on IL-5 inhibition. Further research is needed to define the cytoplasmic cascade that occurs following galectin-3-Fc{gamma}RII interaction and nuclear factors implicated in the IL-5 regulation.


    Materials and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
Reagents
PGEX-galectin-3 with human galectin-3 cDNA cloned between BamHI and EcoRI sites in vector pGEX-5X-3 and monoclonal anti-galectin-3 antibody (BC210) were obtained as described in a previous report (Liu et al., 1996Go).

Probes used in EMSA were: IL-5REIII oligonucleotide 5' GGGATTTTTATTAAAAGATAAAAGTAAATTTATTTTTT- 3' and AP1 Consensus Oligonucleotide: 5' CGCTTGATGAGTCAGCCGGAA 3' (Promega, Madison, WI).

Cells
Peripheral blood was obtained from allergic patients after informed consent and approval by the hospital’s Ethical Committee and used for isolation of eosinophils and lymphocytes. The Allergy Department of Fundación Jiménez Díaz selected patients with extrinsic allergy. Eosinophils from allergic patients were purified following a negative immunoselection technique, using magnetic beads (Hansel et al., 1989Go). PBMC from allergic patients were isolated by density sedimentation gradient (Nycomed Pharma, Oslo, Norway).

A human eosinophilic leukemia cell line (EoL-3) was a generous gift from Dr. R.G.Lynch (University of Iowa, Iowa City, IA).

Mice
Fc{gamma}RII-deficient mice were constructed by Dr. Takai, Department of Experimental Immunology, Institute of Development, Aging and Cancer (IDAC), Tohoku University, Japan (Toshiyuki et al., 1996Go). C57BL/6-CD16 (Fc{gamma}RIII-deficient mice) gene disrupted mice (Hazenbos et al., 1996Go) were constructed by Dr. Sjef Verbeek, Department of Immunology, University of Utrecht, The Netherlands. C57BL/6 wild type mice were used as control.

Flow cytometry
EoL-3 cell line, PBMC and human eosinophils from allergic patients were incubated in presence or absence of galectin-3 (10 µg/ml) for 1 h at 37°C and 5% CO2. These cells were cultured with anti-CD32-PE antibody (Caltag Laboratories, Burlingame, CA) or irrelevant isotype control mAb at 10 µg/ml. After 30 min, cells were washed and fixed with 1% paraformaldehyde. Cells were analyzed by FACs Elite-XL (Cultek). A nonrelated antibody, anti-DR (Caltag Laboratories, Burlingame, CA), was used as control.

Expression and purification of GST-galectin-3 fusion protein and binding reaction
E.coli supercompetent cells (Stratagene, La Jolla, CA) were transformed with pGEX-GST-galectin-3 vector (Sambrook et al., 1989). The transformed E.coli was lysed and the lysate was mixed with 0.5 ml of glutathione–Sepharose 4B for 30 min at 4°C (Gene Fusion System of Pharmacia Biotech, Spain). After three washes with PBS at 4°C, the fusion protein was eluted by adding 1 ml of glutathione elution buffer (100 mM reduced glutathione (Sigma, Madrid, Spain) in sterile distilled water). As a control, we used E.coli supercompetent cells transformed with pGEX-GST vector.

Cells (EoL-3 cell line and PBMC from allergic patients) were lysed with 100 mM TrisHCl pH 7.5, 300 mM NaCl, 2% NP40, 1 mM PMSF, 0.7 µg/ml pepstatin A (Sigma, Spain) and 0.5 µg/ml leupeptin (Sigma, Spain). After centrifugation, 1 µg of GST-galectin-3 or GST alone was added to the lysates. After 2 h at 4°C, 20 µl of glutathione-Sepharose 4B beads were added, and the mixture incubated for 1 h at 4°C. Next, three washes were done with 20 mM HEPES, pH 7.5, 150 mM NaCl, 0.1% Triton X-100, 10% glycerol, and 10 mM Na4P2O7) and, finally, with cold PBS. Samples were eluted with buffer as described above.

Immunoblotting
The samples were electrophoresed on 15% polyacrylamide gels (0.1% SDS-PAGE) and transferred to nitrocellulose membrane (Bio-Rad) in the Trans-Blot cell apparatus (Bio-Rad). The membranes were incubated with mouse anti-CD32 monoclonal antibody (Lander Diagnostic, Madrid, Spain), mouse anti-CD19 (Lander Diagnostic, Madrid, Spain) or anti-galectin-3 antibody, and finally, goat anti-mouse (Fab') 2, labeled with peroxidase (Caltag Laboratories, Burlingame, CA) was added. Proteins were visualized with chemiluminescence reagents according to the manufacturer’s protocol (ECL, Amersham).

Cell cultures
Mice (C57BL/6; Fc{gamma}RII-deficient mice and Fc{gamma}RIII-deficient mice) were treated intraperitoneally with 20 µg of Al(OH)3 in order to induce a Th2 cytokine profile (Victoratos et al., 1997Go). After 5 days blood was drawn and PBMC were purified by density gradient (Lympholyte-M, Cedarlane Laboratories). A total of 1 x 106 cells/ml were cultured in 24-well flat bottom plates (Nunc, Roskilde, Denmark) in RPMI 1640 medium (Life Technologies, Renfrewshire, Scotland) supplemented with sodium pyruvate (5 mM), L-glutamine (2 mM), penicillin (50 U/ml), streptomycin (50 µg/ml; Flow Laboratories, Irvine, Scotland), 2-ME (5 x 10–5 M; Sigma Chemical Co., St. Louis, MO), and 10% heat-inactivated fetal bovine serum (Life Technologies). Cells (1 x 106 cells/ml) were incubated alone, in the presence of galectin-3 (10 µg/ml) or with galectin-3 plus anti-galectin-3 monoclonal antibody (10 µg/ml) for 24 h.

RT-PCR
Total RNA was extracted from cells by the Rneasy mini protocol (Qiagen, Valencia, California, USA). An amount corresponding to 1 µg of RNA was converted to cDNA by the reverse transcriptase enzyme reaction (AMV transcriptase reverse, Promega, Madison, WI) in a total volume of 40 µl.

PCR was performed in a final volume of 50 µl containing 7–10 µl of RT reaction product. ß-actin, IL-5, IL-4, and IFN-{gamma} (Clontech Laboratories, Palo Alto, CA) were amplified following the manufacturer’s instructions. A 20-µl aliquot from each PCR reaction was electrophoresed in a 1.5% agarose gel containing 0.5% ethidium bromide. The gel was then photographed under UV transillumination.

Preparation of nuclear extracts
Nuclear extracts were prepared from 1 x 107 EoL-3 as described previously (Dignam et al., 1983Go). Cells were incubated with galectin-3 (10 µg/ml), or with galectin-3 plus lactose (50 mM). The protein content of the nuclear extracts was determined by the method of BCA (Protein Assay Reagent, Pierce, IL).

Electrophoretic mobility shift assays
Complementary oligonucleotide pair corresponding to human IL-5 region, IL-5REIII (Stranick et al., 1997Go), was synthesized (Progenetic, Madrid, Spain), annealed, and 32P-labeled with [{gamma}32P] ATP (3000 Ci/mmol at 10 Ci/mmol) using T4 polynucleotide kinase (5–10 U/µl) from Promega (Madison, WI).

A total of 10 µl EMSA binding reactions containing 10 µg of total nuclear protein in binding buffer (Promega, Madison, WI) were incubated with 50,000–100,000 cpm of 32P-labeled oligonucleotides (IL-5REIII or AP1) for 20 min at room temperature. Protein-DNA binding specificity was tested by competition assays in which the binding reaction was preincubated for 30 min at room temperature with excess unlabeled IL-5REIII oligonucleotide. Protein-DNA complexes were resolved by electrophoresis in 6% acrylamide gel in nondenaturing conditions.


    Acknowledgments
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
We are indebted to Ms. Paloma Tramón for her help and technical assistance. This work was supported by a grant from FIS (Fondo de Investigaciones Sanitarias, 97/0104-TVI). I.C. and M.R. are recipients of a fellowship from the Fundación "Conchita Rábago" of Fundación Jiménez Díaz and S.G. from the Fondo de Investigaciones Sanitarias. I.A. is recipient of a fellowship from Fundación Lair, Madrid, Spain.


    Footnotes
 
1 To whom correspondence should be addressed Back


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
Bao,Q. and Hughes,C. (1999) Galectin-3 and polarized growth within collagen gels of wild-type and ricin-resistant MDCK renal epithelial cells. Glycobiology, 9, 489–495.[Abstract/Free Full Text]

Brooks,D.G., Qiu,W.Q., Luster,A.D. and Ravetch,J.V. (1989) Structure and expression of human IgG FcRII (CD32). Functional heterogeneity is encoded by the alternatively spliced products of multiple genes. J. Exp. Med., 170, 1369–1385.[Abstract/Free Full Text]

Campbell,H.D., Tucker,W.J., Hort,Y., Martison,M.E., Mayo,G., Clutterbuck,E.J., Sanderson,C.J. and Young,I.G. (1987) Molecular cloning, nucleotide sequence and expression of the gene encoding human eosinophil differentiation factor (interleukin-5). Proc. Natl. Acad. Sci. USA, 84, 6629–6633.[Abstract/Free Full Text]

Cortegano,I., del Pozo,V., Cárdaba,B., de Andrés,B., Gallardo,S., del Amo,A., Arrieta,I., Jurado,A., Palomino,P., Liu,F-T. and Lahoz,C. (1998) Galectin-3 down-regulates IL-5 gene expression on different cell types. J. Immunol., 161, 354–359.

Dignam,J.D., Lebovitz,R.M. and Roeder.R.G. (1983) Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res., 11, 1475–1489.[Abstract/Free Full Text]

Frigeri,L.G. and Liu,F.-T. (1992) Surface expression of functional IgE binding protein, an endogenous lectin, on mast cells and macrophages. J. Immunol., 148, 861–867.[Abstract]

Frigeri,L.G., Zuberi,R.I. and Liu,F-T. (1993) {varepsilon}BP, a ß-Galactoside-binding animal lectin, recognizes IgE receptor (Fc{varepsilon}RI) and activates mast cells. Biochemistry, 32, 7644–7649.[Medline]

Gritzmacher,C.A., Robertson,M. and Liu,F.-T. (1988) IgE binding protein: subcellular location and gene expression in many murine tissues and cells. J. Immunol., 141, 2801–2806.[Abstract]

Grover,W.H., Winkler,H.H. and Normasell,D.E. (1978) Phagocytic properties of isolated human eosinophils. J. Immunol., 121, 718–725.[Abstract/Free Full Text]

Hansel,T.T., Pound,J.D., Pilling,D., Kitas,G.D., Salmon,M., Gentle,T.A., Lee,S.S. and Thopson,R.A. (1989) Purification of human blood eosinophil by negative selection using immunomagnetic beads. J. Immunol. Methods, 122, 97–103.[Web of Science][Medline]

Hazenbos,W.L., Gessner,J.E., Hofhuis,F.M., Kuipers,H., Meyer,D., Heijnen,A.F., Schmidt,R.E., Sandor,M., Capel,P.J., Däeron,M., Winkel,J.G. and Verbeek,J.S. (1996) Impaired IgG-dependent anaphylaxis and Arthus reaction in Fc{gamma}RIII (CD16) deficient mice. Immunity, 5, 181–188.[Web of Science][Medline]

Koenderman,L., Hermans,S.W., Capel,P.J. and Winkel,J.G. (1993) Granulocyte-macrophage colony-stimulating factor induces sequential activation and deactivation of binding via a low-affinity IgG Fc receptor, hFc gamma RII, on eosinophils. Blood, 81, 2413–2419.[Abstract/Free Full Text]

Koths,K., Taylor,E., Halenbeck,R., Casipit,C. and Wang,A. (1993) Cloning and characterization of a human Mac-2-binding protein, a new member of the superfamily defined by the macrophage scavenger receptor cysteine-rich domain. J. Biol. Chem., 268, 14245–14249.[Abstract/Free Full Text]

Liu,F-T. (1990) Molecular biology of IgE-binding protein, IgE-binding factors and IgE receptors. Crit. Rev. Immunol., 10, 289–306.[Web of Science][Medline]

Liu,F-T., Hsu,D., Zuberi,R., Hill,P., Shenhav,A., Kuwabara,I. and Chen,S.S. (1996) Modulation of functional properties of galectin-3 by monoclonal antibodies binding to the non-lectin domains. Biochemistry, 35, 6073–6079.[Medline]

Monteseirín,J., Camacho,M.J., Montaño,R., Llamas,E., Conde,M., Carballo,M., Guardia,P., Conde,J. and Sobrino,F. (1996) Enhancement of antigen-specific functional responses by neutrophils from allergic patients. J. Exp. Med., 183, 2571–2579.[Abstract/Free Full Text]

Moutsatsos,I.K., Wade,M., Schindler,M. and Wang,JL. (1987) Endogenous lectins from cultured cells: nuclear localization of carbohydrate-binding protein 35 in proliferating 3T3 fibroblasts. Proc. Natl. Acad. Sci. USA, 84, 6452–6456.[Abstract/Free Full Text]

Nambu,M., Watanbe,H., Kim,K.M., Tanaka,M., Mayumi,M. and Mikawa,H. (1991) Regulation of Fc{gamma} receptor subtype expression on a human eosinophilic leukemia cell line EoL-3: participation of cAMP and protein kinase C in the effects of interferon-{gamma} and phorbol ester. Cell. Immunol., 133, 27–40.[Web of Science][Medline]

Plaut,M., Pierce,J.H., Watson,C.J., Hanley-Hyde,J., Nordan,R.P. and Paul,W.E. (1989) Mast cell lines produce lymphokines in response to cross-linkage of Fc{varepsilon}IR or to calcium ionophores. Nature, 339, 64–67.[Medline]

Robertson,M.W. and Liu, F-T. (1991) Heterogeneous IgE glycoforms characterized by differential recognition of an endogenous lectin (IgE-binding protein). J. Immunol., 147, 3024–3029.[Abstract]

Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 74–81.

Sato,S. and Hughes,R.C. (1994) Regulation of secretion and surface expression of Mac-2, a galactoside-binding protein of macrophages. J. Biol. Chem., 269, 4424–4430.[Abstract/Free Full Text]

Stranick,K.S., Zambas,D.N., Schettino-Uss,A., Egan,R.W., Billah,M.M. and Umland,S.P. (1997) Identification of transcription factor binding sites important in the regulation of the human interleukin-5 gene. J. Biol. Chem., 26, 16453–16465.

Toshiyuki,T., Ono,M., Hikida,M., Ohmori,H. and Ravetch,J.V. (1996) Augmented humoral and anaphylactic responses in Fc{gamma}RII-deficient mice. Nature, 379, 346–349.[Medline]

Truong,M-J., Gruart,M., Liu,F-T., Prin,L., Capron,A. and Capron,M. (1993). IgE-binding molecules (Mac-2/{varepsilon}BP) expressed by human eosinophils. Implication in IgE-dependent eosinophil cytotoxicity. Eur. J. Immunol., 23, 3230–3235.[Web of Science][Medline]

Victoratos,M., Yiangou,M., Avramidis,N. and Hadjipetrou,L. (1997) Regulation of cytokine gene expression by adjuvants in vivo. Clin. Exp. Immunol., 109, 569–578.[Web of Science][Medline]

Yamaoka,K.A., Arock,M., Issaly,F., Dugas,N., Le Goff,L. and Kolb,J.P. (1996) Granulocyte macrophage colony stimulating factor induces Fc epsilon RII/CD23 expression on normal human polymorphonuclear neutrophils. Int. Immunol., 8, 479–490.[Abstract/Free Full Text]

Zuberi,R., Frigeri,L.G. and Liu,F-T. (1994). Activation of rat basophilic leukemia cells by epsilon BP, an IgE-binding endogenous lectin. Cell Immunol., 156, 1–12.[Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
IOVSHome page
C. Saravanan, Z. Cao, S. R. Head, and N. Panjwani
Detection of Differentially Expressed Wound-Healing-Related Glycogenes in Galectin-3-Deficient Mice
Invest. Ophthalmol. Vis. Sci., December 1, 2009; 50(12): 5690 - 5696.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
F. L. Oliveira, P. Frazao, R. Chammas, D. K. Hsu, F. T. Liu, R. Borojevic, C. M. Takiya, and M. C. El-Cheikh
Kinetics of mobilization and differentiation of lymphohematopoietic cells during experimental murine schistosomiasis in galectin-3 / mice
J. Leukoc. Biol., August 1, 2007; 82(2): 300 - 310.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Lopez, V. del Pozo, T. Miguel, B. Sastre, C. Seoane, E. Civantos, E. Llanes, M. L. Baeza, P. Palomino, B. Cardaba, et al.
Inhibition of Chronic Airway Inflammation and Remodeling by Galectin-3 Gene Therapy in a Murine Model
J. Immunol., February 1, 2006; 176(3): 1943 - 1950.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. V. Acosta-Rodriguez, C. L. Montes, C. C. Motran, E. I. Zuniga, F.-T. Liu, G. A. Rabinovich, and A. Gruppi
Galectin-3 Mediates IL-4-Induced Survival and Differentiation of B Cells: Functional Cross-Talk and Implications during Trypanosoma cruzi Infection
J. Immunol., January 1, 2004; 172(1): 493 - 502.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
V. del Pozo, M. Rojo, M. L. Rubio, I. Cortegano, B. Cardaba, S. Gallardo, M. Ortega, E. Civantos, E. Lopez, C. Martin-Mosquero, et al.
Gene Therapy with Galectin-3 Inhibits Bronchial Obstruction and Inflammation in Antigen-challenged Rats through Interleukin-5 Gene Downregulation
Am. J. Respir. Crit. Care Med., September 1, 2002; 166(5): 732 - 737.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
G. A. Rabinovich, N. Rubinstein, and L. Fainboim
Unlocking the secrets of galectins: a challenge at the frontier of glyco-immunology
J. Leukoc. Biol., May 1, 2002; 71(5): 741 - 752.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (25)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Cortegano, I.
Right arrow Articles by Lahoz, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cortegano, I.
Right arrow Articles by Lahoz, C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?