Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (11)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Müller-Loennies, S.
Right arrow Articles by Narang, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Müller-Loennies, S.
Right arrow Articles by Narang, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Glycobiology, 2000, Vol. 10, No. 2 121-130
© 2000 Oxford University Press

Characterization of high affinity monoclonal antibodies specific for chlamydial lipopolysaccharide

Sven Müller-Loennies1,2,3, C.Roger MacKenzie3, Sonia I. Patenaude4, Stephen V. Evans4, Paul Kosma5, Helmut Brade2, Lore Brade2 and Saran Narang3

2Division of Biochemical and Medical Microbiology, Borstel Research Center, Parkallee 22, D-23845 Borstel, Germany, 3Institute for Biological Sciences, National Research Council of Canada, Ottawa, Ontario, Canada K1A 0R6, 4Department of Biochemistry, University of Ottawa, Ottawa, Ontario, Canada K1H 8M5, and 5Institute of Chemistry, University of Agri­cul­ture, A-1190 Vienna, Austria

Received on May 17, 1999; revised on August 16, 1999; accepted on August 17, 1999.


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
Pathogens belonging to the genus Chlamydia contain lipopolysaccharide with a 3-deoxy-D-manno-oct-2-ulosonic acid (Kdo) trisaccharide of the sequence {alpha}-Kdo-(2->8)-{alpha}-Kdo-(2->4)-{alpha}-Kdo. This lipopolysaccharide is recognized in a genus-specific pattern by murine monoclonal antibodies (mAbs), S25–23 and S25–2 (both IgG1{kappa}), which bind as the minimal structures the trisaccharide and the terminal Kdo-disaccharide, respectively. The variable domains of these mAbs were reverse transcribed from mRNA which was isolated from hybridomas and cloned as single-chain variable fragments (scFvs) in E.coli TG1. The kinetics of binding of whole antibodies, Fab fragments and scFvs to natural and synthetically modified ligands were determined by surface plasmon resonance (SPR) using synthetic neoglycoconjugates. As examples of an antibody–carbohydrate interaction involving anionic carboxyl groups on the ligand, we report that the affinities of these antibodies are higher than usually observed in carbo­hydrate-protein interactions (KD of 10–3 to 10–5 M). SPR analy­ses of monovalent Fab and scFv binding to the natural trisaccharide epitope gave dissociation constants of 770 nM for S25–2 and 350 nM for S25–23, as determined by global fitting (simultaneous fitting of several measurements at different antibody concentrations) of sensorgram data to a one-to-one interaction model. Local fitting (separate fitting of individual sensorgram data at different antibody concentrations) and Scatchard analysis of the data gave kinetic and affinity constants that were in good agreement with those obtained by global fitting. The SPR data also showed that while S25–2 bound well to several Kdo disaccharides and carboxyl-reduced Kdo ligands, S25–23 did not. Identification of amino acids in the complementarity determining regions revealed the presence of a large number of positively charged amino acids which were located towards the center of the combining site, thus suggesting a different recognition mechanism than that observed for neutral ligands. The latter mainly involves aromatic amino acids for hydrophobic stacking inter­actions and hydrogen bonds.

Key words: anti-carbohydrate antibodies/Chlamydia/lipopolysaccharide/scFv/surface plasmon resonance


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
The genus Chlamydia is comprised of four species, C.psittaci, C.trachomatis, C.pneumoniae, and C.pecorum, which are pathogenic, obligatory intracellular bacteria causing a variety of acute and chronic diseases in animals and humans (Nurminen et al., 1983Go; Caldwell and Hitchcock, 1984Go; Moulder, 1991Go). Acute infections include conjunctivitis, lower genital tract infections, and respiratory tract infections that can be treated with antibiotics. Chronic infections, however, cause severe sequelae such as reactive arthritis, blinding trachoma, or occluding salpingitis. Most importantly infections with C.pneumoniae are postulated to be involved in the development of bronchial asthma, chronic obstructive pulmonary disease, artherosclerosis, and Alzheimer’s disease. Due to a unique developmental cycle that comprises metabolically active intracellular and metabolically inactive extracellular stages, Chlamydiae have the ability to persist for extended periods of time without clinical symptoms. Therefore, it is questionable if an effective eradication of Chlamdiae by antibiotic treatment alone is possible. Since the only alternative approach at present is the development of a vaccine which induces antibodies of high affinity, we have focused our interest on Chlamydia-specific antibodies.

All chlamydiae possess in their outer membrane a lipopolysaccharide (LPS), which contains a genus-specific epitope composed of a 3-deoxy-D-manno-oct-2-ulosonic acid (Kdo) trisaccharide of the sequence {alpha}–Kdo-(2->8)-{alpha}–Kdo-(2->4)-{alpha}–Kdo (Brade et al., 1997Go). This structure is highly immunogenic, resulting in the formation of high-affinity antibodies after natural or experimental infection or after immunization, and may therefore be particularly well suited as a target for vaccine development. To this end, we have synthesized a panel of neoglycoconjugates containing the synthetic Kdo-trisaccharide conjugated to bovine serum albumin (BSA) via a cysteamine spacer (Fu et al., 1992Go), and have used these antigens to generate and characterize several anti-Kdo monoclonal antibodies. Some of these antibodies are strictly Chlamydia-specific, with no observed cross-reactivity with any other bacterial LPS structures. These specific antibodies (types C and D in Figure 1) require either the complete trisaccharide or the {alpha}-2->8-linked disaccharide for binding. (Fu et al., 1992Go). This specificity is based on the fact that the {alpha}–2->8-linkage between two Kdo residues occurs only in chlamydial LPS. Antibodies binding to a single Kdo or to the {alpha}–2->4-linked disaccharide portion of chlamydial LPS (types A and B in Figure 1) cross-react with LPS of various bacterial species, since these structural elements are widespread in LPS molecules.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 1. Chemical and antigenic structure of the Kdo-region of chlamydial LPS. The epitope-specificity of antibodies recognizing (A) terminal {alpha}–Kdo, (B) {alpha}–(2->4)-Kdo-disaccharide, (C) {alpha}–(2->8)-Kdo-disaccharide and (D) {alpha}–Kdo-(2->8)-{alpha}–Kdo-(2->4)-{alpha}–Kdo-trisaccharide is indicated. R represents the lipid A moiety of LPS and -(CH2)3-S-(CH2)2-NH-CS-NH-BSA (5) in neoglycoconjugates.

 
Presently, relatively little is known about carbohydrate specific antibodies, especially those directed against charged sugar residues. An exception are antibodies directed against {alpha}2->8-linked polysialic acid (Sato et al., 1995Go; Patenaude et al., 1998Go). Antibodies specific for chlamydial LPS are, in addition, well suited for the study of antibody–carbohydrate interactions due to the availability of modified ligands obtained by chemical syntheses. Such antibodies may thus provide insight into the molecular details of the interaction of these antibodies with acidic Kdo-containing epitopes. In order to determine the affinities and specificities of these antibodies, we have characterized the binding of monovalent Fab and scFv fragments of the di- and trisaccharide specific antibodies using a panel of neoglycoconjugates. In an effort to gain insight into the antibody response at the molecular level, and into the molecular basis of the high affinity that these antibodies show relative to other carbohydrate binding proteins, the primary structures were compared with each other and to other antibodies of known structure.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
Sequence analysis
Analysis of the cDNA sequences encoding for S25–2 and S25–23 and a comparison of these sequences with those in the Kabat database (Kabat et al., 1987Go; Martin, 1998) revealed that the VL of S25–2 belonged to family II while the VL of S25–23 belonged to family IV. The VH domains of S25–2 and S25–23 belonged to families X and IV, respectively. A comparison of the primary structure of the variable domains of S25–2 and S25–23 (Figures 2, 3) showed extensive homologies with two other anti-carbohydrate antibodies, Yst9.1 (Bundle et al., 1989Go) and BR96 (Hellström et al., 1990Go). Apart from three differences in CDR (complementarity determining region) positions, the primary structure of the VL of the trisaccharide-specific antibody S25–23 was found to be identical to that of BR96 which is specific for the tumor-associated Lewis Y oligosaccharide antigen. The S25–2 VH domain was highly homologous with the VH of Yst9.1, which is specific for the A antigen of Brucella. Surprisingly, although both mAbs S25–2 and S25–23 are highly specific for the same antigen they differed to a great extent in their primary structures as a result from different germ-line gene usage. Nevertheless, a common feature of both mAbs is the presence of a large number of positively charged amino acid residues in their CDR-loops. In particular the combining site of mAb S25–2 is characterized by the presence of a 13 positively charged amino acid cluster near the center of the combining site. This creates a highly polar surface that could potentially form salt bridges with the carboxyl groups of Kdo residues in the antigen.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 2. Alignment of S25–2 and S25–23 VL sequences with sequences from other murine monoclonal antibodies. Amino acids different in BR96 as compared to S25–23 are underlined.

 
It has previously been shown that VL and VH domains of antibodies can be interchanged between antibodies of similar specificities without the loss of activity. Further, it has been reported that the antibody response against the cell-wall polysaccharide of group A Streptococcus elicits an antibody response with highly restricted VH-gene usage (Harris et al., 1997Go), which is presumed to recognize very similar or identical epitopes. Since mAbs S25–2 and S25–23 both specifically recognize 2->8 interlinked Kdo-residues in chlamydial LPS and have been shown to bind, as minimal structures, the Kdo-disaccharide and Kdo-trisaccharide, respectively, we sought to determine whether the conformations of the VL and VH domains were similar in allowing the proper folding and interaction with the ligand, despite having different primary structures. Interchanging the domains of scFv 25–23 with the domains of scFv 25–2 revealed that the chimeric scFv containing the VL domain of S25–23 and the VH domain of S25–2 did not bind the antigen as determined by SPR, although both antibodies can bind the same antigen with high affinity. In view of this result and the difficulty in obtaining reasonable yields of soluble product, the second chimera was not characterized. The yields of soluble product of wild-type scFvs differed significantly (~15-fold less for scFv 25–23) although both scFvs showed similar expression levels in E.coli TG1, as assessed from immunoblots of overnight cultures. The S25–23 VL/S25–2 VH chimera gave amounts of soluble scFv that were comparable to the wild-type scFv 25–2, whereas the chimeric scFv containing the VH-domain of S25–23 gave poor yields, indicating that the S25–23 VH-domain was responsible for poor scFv yields.

Antibody specificities
The specificities of S25–2 and S25–23 for different Kdo mono-, di- and trisaccharides were determined by SPR monitoring of IgG binding to BSA-sugar conjugates immobilized on sensor chip surfaces. The binding profiles obtained (results not shown) for the two antibodies at concentrations of 50 nM and similar surface densities (1500–1800 RU (resonance units)) showed that S25–2 IgG bound to all conjugates. Kinetic analyses of the sensorgrams indicated that the strongest binding occurred with the {alpha}–Kdo-(2->8)-{alpha}–Kdo-(2->4)-{alpha}–Kdo-trisaccharide conjugate. This was attributable to a much slower dissociation rate for this conjugate relative to the other six. Since similar conjugate surface densities were used in all experiments, the lack of correlation between the affinity of the interaction and the response levels may be due to varying degrees of substitution of BSA with ligand and/or differences in the accessibility of the conjugated ligands to antibody. The S25–23 antibody showed a strong preference for the two trisaccharide antigens {alpha}–Kdo-(2->8)-{alpha}–Kdo-(2->4)-{alpha}–Kdo and {alpha}-Kdo-(2->8)-{alpha}–KdoC1red-(2->4)-{alpha}–Kdo and exhibited little or no binding to the other glycoconjugates.

Antibody affinities
Binding constants were determined by SPR for the binding of {alpha}–Kdo-(2->8)-{alpha}–Kdo-(2->4)-{alpha}–Kdo by the IgG, Fab, and scFv forms of S25–2 and S25–23 (Table I). When purified monovalent preparations were assayed, very similar affinity constants were obtained for the Fab and scFv forms of each antibody (Table I). Much higher functional affinities were observed for whole antibodies because of the avidity effect resulting from IgG bivalency. This manifested itself in slower dissociation rate constants and led to a 100-fold increase in functional affinity for S25–2 IgG relative to Fab and a somewhat smaller increase, approximately 40-fold, for S25–23 on {alpha}-Kdo-(2->8)-{alpha}-Kdo-(2->4)-{alpha}-Kdo surfaces. Varying proportions of monovalent and bivalent binding can lead to these discrepancies.


View this table:
[in this window]
[in a new window]
 
Table I. Kinetics of {alpha}-Kdo-(2->8)-{alpha}-Kdo-(2->4)-{alpha}-Kdo binding by IgG, Fab and scFv forms of S25–2 and S25–23 as determined by surface plasmon resonance
 
Since valency effects can seriously compromise calculations of rate constants and intrinsic affinities (MacKenzie et al., 1996Go; Myszka, 1997Go), monovalent scFvs were used for determining the affinities of the two antibodies for different Kdo-containing antigens conjugated to BSA (Table II). MAb S25–2 exhibited the highest affinity for {alpha}-Kdo-(2->8)-{alpha}-Kdo-(2->4)-{alpha}-Kdo; KD values of 590 nM and 770 nM were obtained by local and global fitting, respectively. At the concentrations tested, S25–23 scFv was observed to bind only to the immo­bilized {alpha}-Kdo-(2->8)-{alpha}-Kdo-(2->4)-{alpha}-Kdo-trisaccharide. The KD of this interaction was determined to be 220 nM and 350 nM by local and global fitting, respectively indicating that the intrinsic affinity of S25–23 for this ligand is ~3-fold higher than that observed for S25–2 scFv on this surface. Local and global fitting of the data for both scFvs to the natural epitope in chlamydial LPS showed good agreement with a simple one-to-one interaction (Figures 4, 5). Although monomeric scFv fractions were collected immediately prior to SPR analysis, the slight deviation of the S25–2 data from the fitted lines in the latter part of the association phases (Figure 4A,B) indicated the presence of dimeric product. However, the contamination was minor and did not compromise the quality of the data. There was no evidence of dimer contamination of the S25–23 preparation, with the data exhibiting excellent fitting to the model at all stages of the association and dissociation and at all scFv concentrations (Figure 5A,B).


View this table:
[in this window]
[in a new window]
 
Table II. Kinetics of Kdo-binding by S25–2 and S25–23 single-chain Fvs as determined by surface plasmon resonance
 


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 4. Kinetic data for the binding of S25–2 scFv binding to {alpha}-Kdo-(2->8)-{alpha}-Kdo-(2->4)-{alpha}-Kdo surfaces. The data (open circles) represent five injections of scFv at concentrations of 200, 400, 600, 800, and 1000 nM over surfaces containing 3,150 RU of immobilized conjugate. Local (A) and global (B) fitting of the sensorgram data to a 1:1 reaction are shown as solid lines.

 


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 5. Kinetic data for the binding of S25–23 scFv binding to {alpha}-Kdo-(2->8)-{alpha}-Kdo-(2->4)-{alpha}-Kdo surfaces. The data (open circles) represent five injections at scFv concentrations of 20, 40, 60, 80, and 100 nM over surfaces containing 3150 RU of immobilized conjugate. Local (A) and global (B) fitting of the sensorgram data to a 1:1 reaction are shown as solid lines.

 
With the exception of the {alpha}-Kdo ligand, the affinities for the other Kdo structures were in the 1–2 µM range, as determined by separate fitting of the association and dissociation phases to a 1:1 interaction model. The data for the reduced trisaccharide and all disaccharide ligands was not amenable to simultaneous fitting of the association and dissociation phases. Since the lower affinities necessitated the use of higher scFv concentrations, the trace amounts of dimeric scFv resulted in more pronounced biphasic binding than observed at lower concentrations. Nonetheless, the rapid association and dissociation phases, attributable to monomer binding, gave linear dR/dt vs. R and ln[R(t0)/R(t)] vs. time plot for the association and dissociation phases, respectively, making it possible to derive rate constants from this data. Only affinity data could be derived for the interaction with the {alpha}-Kdo ligand with a Scatchard plot giving a KD value of 15 µM.

Scatchard analysis of the data for S25–2 binding to the {alpha}-Kdo-(2->8)-{alpha}-Kdo-(2->4)-{alpha}-Kdo-trisaccharide (Figure 6) gave a KD value of 1.1 µM (Table II). This value is in reasonable agreement with the values of 590 nM and 770 nM derived from the rate constants obtained by local and global fitting, respectively. Due to low yields, the S25–23 scFv was not available at the concentrations needed for accurate Scatchard analysis.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 6. Scatchard analysis of S25–2 scFv binding to {alpha}-Kdo-(2->8)-{alpha}-Kdo-(2->4)-{alpha}-Kdo surfaces.

 

    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
The variable domains of two previously isolated monoclonal antibodies, S25–2 and S25–23, which have been shown by ELISA to bind chlamydial lipopolysaccharide with high affinity (Fu et al., 1992Go) were cloned and expressed in E.coli TG1 as single-chain Fvs. The binding constants of these scFvs were compared to those of Fab fragments and the parent bivalent mAbs. The SPR analyses revealed for a monovalent interaction uncharacteristically high affinities for anti-carbohydrate antibodies with KD values of 350 nM for the trisaccharide-specific scFv and 770 nM for the disaccharide-specific scFv, as determined by global fitting of the sensorgram data. The weaker affinity of the disaccharide-specific S25–2 scFv may be explained by fewer interactions with the smaller ligand. The kinetic and affinity data obtained with the scFvs were in good agreement with that obtained with Fabs derived from the monoclonal antibodies, indicating proper folding of the scFvs in E.coli.

Several precautions were taken to ensure the reliability of the biosensor data. Binding constants for the interactions of the two antibodies with different ligands were derived from data for the binding of high quality monovalent scFv to immobilized ligand, thus avoiding the pitfalls arising from avidity effects (MacKenzie et al., 1996Go; Myszka, 1997Go). The consistency between KD values obtained from kinetic and equilibrium binding data attested to the quality of the samples and validity of the experimental design. The data withstood the demands of global analysis, which showed good fitting to a simple one-to-one reaction model.

The gene usage by the two Kdo-specific antibodies is similar to that of other anti-carbohydrate antibodies and does not appear to contribute to their high affinities relative to other carbohydrate-specific antibodies. The molecular analysis of anti-carbohydrate antibodies has indicated that the antibody response to some carbohydrate antigens involves a restricted set of germline genes (Crews et al., 1981Go; Lutz and Davie, 1988Go; Scott et al., 1989aGo,b) whereas the antibody response to LPS from Pseudomonas aeruginosa was encoded by diverse VH and V{kappa} genes (Emara et al., 1995Go). The VH of S25–2 showed a high sequence homology to Yst9.1 (Bundle et al., 1989Go), which is specific for the A antigen of Brucella, suggesting usage of a gene that is preferentially used by anti-carbohydrate antibodies. Similarly, the VL of S25–23 showed a high sequence homology with BR96 (Hellström et al., 1990Go), which binds the Ley oligosaccharide and may be further indication that certain germline families are preferentially selected in the immune response to carbohydrates. However, the S25–2 VL showed sequence homology to the HyHEL-5 VL, an antibody against lysozyme (Padlan, 1994Go). The usage of the same gene family in response to lysozyme and carbohydrates shows that the restriction is not exclusive. In contrast to the antibody response against the cell-wall polysaccharide of group A Streptococcus, which elicits an antibody response with highly restricted VH-gene usage (Harris et al., 1997Go) and is presumed to recognize very similar or even identical epitopes the primary structures differed to a great extent in both Chlamydia-specific mAbs. A common feature, however, is a high number of basic amino acids, which are located at the center of the combining sites, creating a highly positively charged surface. Ionic interactions may, therefore, play a key role in recognition of the anionic antigens by these antibodies. In a previous study (Brade et al., 1997Go), we investigated the importance of negative charges on the ligand in antigen binding by S25–2 and S25–23. Binding to ligands in which the carboxyl groups were selectively reduced was abolished for antibody S25–23. An exception was the binding to the Kdo-trisaccharide ligand in which the negative charge on the internal Kdo-residue was eliminated by reduction. In this case the affinity was considerably reduced, as assessed by ELISA and SPR analyses. NMR analyses showed that the removal of a negative charge on the trisaccharide was accompanied by a conformational change in the ligand. The conformation of the Kdo-trisaccharide in which the internal Kdo residue had been reduced showed the closest structural similarity to the natural ligand (Brade et al., 1997Go), suggesting that steric hindrance may explain the decreased binding. The low affinities of most anti-carbohydrate antibodies appear to be related to rapid dissociation rates (MacKenzie et al., 1996Go). A tight interaction involving opposite charges may explain the slower dissociation rates observed with S25–2 and S25–23. Relatively fast association rates also contribute to the high affinities of these antibodies and could arise from the conformational properties of the antigens. Transfer NOE measurements of the antigen in complex with mAb S25–2 in combination with conformational analysis performed on the free {alpha}–2->8-linked Kdo-disaccharide provided evidence that the conformation of this ligand does not change upon binding (Sokolowski et al., 1998Go). The NMR-determined conformation was similar to the conformation of the crystallized ligand (Mikol et al., 1994Go).

The involvement of ionic interactions in antigen binding would represent a different type of recognition than has been observed in the two crystal structures of antibodies in complex with carbohydrate antigens that have been determined at high-resolution (Cygler et al., 1991Go; Jeffrey et al., 1995Go). In these complexes, stacking interactions and hydrogen bonds formed between antigen and antibody were predominantly responsible for the interactions resulting in comparatively low affinity binding. These examples showed that the binding of carbo­hydrate ligands by antibodies is different from other carbo­hydrate-binding proteins such as transport proteins and lectins, in which the interactions involve mainly carboxy and amide side chains of aspartic acid, asparagine, glutamic acid, and glutamine, which form hydrogen bonds and aromatic groups stack with hexose rings (Vyas, 1991Go; Bundle and Young, 1992Go).

It has been shown in many instances (Smith-Gill et al., 1986Go; Radic et al., 1991Go; Kang et al., 1991Go; Collet et al., 1992Go; Cooper et al., 1993Go; Jespers et al., 1994Go; Burton and Barbas, 1994Go) that the VH-domain was the main determinant for the specificity of an antibody, and that the affinity was modulated by VL. Interchange of light chains between antibodies has been performed successfully in some instances, particularly between DNA-binding antibodies, without abolishing the reactivity. However, other examples have shown that the interchange of VL abolishes binding (Dinh et al., 1996Go). Interchanging the domains of scFv 25–23 with scFv 25–2 abolished the activity although both bind the same antigen with high affinity. We hypothesize that this may be due to a conformational change that results in the loss of contact sites on VL, an alteration in the conformation of VH induced by the new VL or from obstruction of contact sites on VH. Elucidation of this mechanism is beyond the scope of the present study. It has become evident that carbohydrate epitopes are quite small, comprising only a few functional groups on the antigen. Therefore, even a trisaccharide may contain a number of different epitopes. Although S25–2 and S25–23 can both bind the same antigen, the interaction with the terminal disaccharide may be different. This hypothesis is supported by the different kinetics of binding observed for the two antibodies. Whereas kon is shorter for the bivalent antibody S25–2 than for S25–23, the slower dissociation rate of S25–23 leads to an overall higher affinity of S25–23. The same holds true for monovalent Fab fragments and scFv.

The molecular analysis of antibodies that are directed against chlamydial LPS has provided insight into the molecular mechanisms that are involved in the high affinity interaction of these antibodies with carbohydrate antigens. The exceptional affinities of the anti-Kdo antibodies described here imply that there may be a biological reason for the low affinities of anti-carbohydrate antibodies, in some instances at least. If the acidic nature of the Kdo antigens is responsible for these high affinities, it would be expected that other anti-carbohydrate antibodies with similar affinities could arise in an immune response since acidic residues, notably sialic acid, are commonly found in carbohydrates in many mammalian glyco­lipids and glycoproteins. For example, specific antibodies reactive against tumor cells in pathological conditions may cross-react with common epitopes on normal cells with reasonable affinity and are therefore eliminated by antibody-mediated cytotoxicity. A well-characterized mAb, R24, which is specific for the disialoganglioside GD3, is known to have low intrinsic affinity for its acidic glycolipid antigen, but relies on an avidity gained from homophilic binding for efficient binding to GD3 bearing membranes (Kaminski et al., 1998Go). The R24 antibody recognizes tumor cells that overexpress GD3. It has been proposed that the homophilic binding provides a mechanism whereby the antibody binds effectively only above a threshold level of GD3. This mechanism would prevent binding to normal cells that express lower levels of GD3 (Kaminski et al., 1998Go). The immune system may therefore use different strategies to discriminate between normal and pathological conditions in bacterial infections vs. self-antigens. Since Kdo is not found in mammalian cells, the immune system does not require any precautionary treatment during immune surveillance.


    Materials and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
Materials
The generation and production of monoclonal antibodies S25–2 and S25–23 and characterization of their specificity has been described previously (Fu et al., 1992Go). Restriction enzymes and DNA-modifying enzymes were purchased from New England Biolabs (Mississauga, Ontario, Canada). Oligonucleotides were synthesized on an Applied Biosystems Inc. (Foster City, CA) 380A automatic DNA synthesizer.

PCR amplifications and construction of scFvs
All DNA manipulations were carried out essentially as described by Sambrook et al., (Sambrook et al., 1989Go). Plasmid isolation was performed using kits from Qiagen. DNA sequencing was carried out using a Taq fluorescent dideoxy termination cycle sequencing kit (Applied Biosystems Inc.) and a 373 automated DNA sequencer (Applied Biosystems Inc.).

The following primers were used for isolation of the antibody variable genes of S25–2 and S25–23: S25–2 VL reverse, 5'-GGGGAATTCGA(C,T)AT(ACT)GTNATGTC­N­CA(AG)TCNCC-3'; S25–2 VL forward, 5'-GGGAAGCTT­C­AAGAAGCACACGACTGAGGCAC-3'; S25–2 VH reverse, 5'-GGGGAATTCGAGGTGAAGCTGGTNGA(AG)TCN­G­GNGGNG-G-3'; S25–2 VH forward, 5'-GGGAAGCTTGTC­ACCATGGAGTTAGTTTGGGC-3'; S25–23 VL reverse, 5'-GG­GGAATTCGA(CT)GTNCTNATGACNCA(AG)ACN­CC-3'; S25–23 VL forward, 5'-GGGAAGCTTCAAGAAGCACACGACTGAGGCAC-3'; S25–23 VH reverse, 5'-GGGGAATTC(CG)AGGTN(AC)A(AG)CTN(CG)(AT)G(CG)AGTC-3'; S25–23 VH forward, 5'-GGGAAGCTTGTCACCATGGAGTTAGTTTGGGC-3'. Reverse primers were based on the N-terminal amino acid sequence of VL and VH domains of S25–2 and the VL domain of S25–23. A degenerate reverse primer was used for the S25–23 VH sequence since an amino acid sequence could not be determined because of N-terminal blockage. Total mRNA was isolated from 4.3 x 107 hybridoma cells using the RNeasy kit from Qiagen (Mississauga, ON) and antibody genes were reverse transcribed into first strand cDNA using the forward primers listed above and a cDNA-synthesis kit (Pharmacia Biotech, Baie d’Urfé, QC). For PCR amplification, the above primers and Taq polymerase were used in 50 µl reactions under the following conditions: 94°C/3 min, then 30 cycles of 94°C/30 s, 50°/60 s, 70°/30 s. The annealing temperature was reduced to 40°C for reverse transcription of S25–23 VH due to the higher degeneracy. The obtained PCR products were purified, digested with EcoRI/HindIII, ligated into pUVC-9, and used for transformation of E. coli TG1 by electroporation (Gene Pulser electroporator, Bio-Rad Laboratories Ltd., Mississauga, Ontario, Canada) according to the manufacturer’s instructions. Clones harboring each VH and VL gene were sequenced and compared to known mouse antibody sequences (Martin, 1998). Based on the obtained sequences, the following primers were used to allow for cloning into the expression vector pSJF8 by introduction of EcoRI, BspEI, and BglII sites: S25–2 VL reverse, 5'-GGGGAATTCAT­GA­A­A­A­AAACCGCTATCGCGATCGCAGTTGCACTGGCTGGTT­TCGCTACCGTT-GCGCAGGCCGATATTGTGATGTC­A­CAGTCTCCA-3'; S25–2 VL forward, 5'-GGGTCCGG­A­A­C­CGCCACCGCCGGAACCGCCACCGCCAGCCCGTTTG­A­TTTCCAGCTT-3'; S25–2 VH reverse, 5'-GG­GT­CC­GG­AG­­CGGTGGCTCCGGCGGTGGCGGTGAGGTGAAGC­TG­G­T­CGAATCG-3'; S25–2 VH forward, 5'-GGGAGATCTTG­C­A­GAGACAGTGACCAG-3'; S25–23 VL reverse, 5'-GG­G­G­AATTCATGAAAAAAACCGCTATCGCGATCGCAGTT­GCACTGGCTGGTTTCGCTACCGTTGCGCAGGCCGAC­GTCCTAATGACACAGACTCCA-3'; S25–23 VL forward, 5'-GGGTCCGGAACCGCCACCGCCGGAACCGCCACC­GCCAGCCCGTTTTATTTCCAGCTTGGT-3'; S25–23 VH reverse, 5'-GGGTCCGGA-GGCGGTGGCTCCGGCGGTG­GCGGTGAGGTACAACTGCAGGAGTCA-3'; S25–23 VH forward, 5'-GGGGGATCCGTTCAAATCTTCCTCACTGA­TTAGCTTCTGTTCAGATCTTGCAGAGACAGTGACC­A­GAGTCCC-3. Single-chain Fv assembly was achieved by separate cloning of VL and VH genes using EcoRI and Kpn2 I sites for VL and Kpn2 I and BglII sites for VH. The above primers add extensions to the VL sequences and to the VH sequences which encode the ompA-leader sequence (5' of VL), half of the linker (3' of VL, and 5' of VH), c-myc and 5xHis tags (3' of VH). The linker sequence was GGGG(SGGGG)3. Appropriately cut VL and VH PCR-products were ligated into pSJF8 and used for transformation of E.coli TG1. Screening by DNA sequencing and SDS-PAGE/Western-blotting revealed clones harboring scFv genes. Cultures grown for 16 h in 25 ml TB/Amp were subjected to periplasmic extraction by an osmotic shock pro­cedure and the obtained fractions were analyzed for the presence of soluble scFv by SDS-PAGE/Western blotting as described previously (Anand et al., 1991Go).

Expression and isolation of soluble scFv
The expression of soluble scFv and its isolation from the periplasm was achieved as described previously (Anand et al., 1991Go). Periplasmic extracts were dialyzed against 10 mM HEPES pH 7.0 and the scFv isolated by Interaction Metal Affinity Chromatography (IMAC) using HiTrap columns (Pharmacia Biotech). Bound protein was eluted using a gradient of 50 mM to 500 mM imidazole in HEPES buffer pH 7.0. The eluent was collected in 1 ml fractions and fractions were further analyzed by SDS-PAGE (12.5%) and staining with Coomassie brilliant blue.

Preparation of monoclonal antibodies and Fab fragments
S25–2 was purified from ascites by Protein G affinity chromatography. Protein G Sepharose (Pharmacia Biotech) was equilibrated with 20 bed volumes of binding buffer (100 mM sodium citrate, 300 mM NaCl, pH 5.3). The ascite sample was then diluted with equal parts of binding buffer and incubated with the Protein G Sepharose for 30 min with continuous mixing. The mixture was centrifuged at 200 x g for 5 min, and the unbound fraction was decanted. The Protein G resin was resuspended in binding buffer, loaded into a column, and washed with binding buffer until the A280 of the flowthrough reached ~0.02. The S25–2 IgG was then eluted with 100 mM sodium citrate pH 3.0 and collected in 1.5 ml fractions. Fractions containing IgG, as determined by A280, were pooled and dialyzed against 20 mM sodium acetate, 100 mM NaCl, pH 5.4. S25–23 IgG was prepared as described previously (Fu et al., 1992Go).

Fab fragments of S25–2 and S25–23 mAbs were prepared by digestion with mercuripapain (Sigma, St. Louis, MO) activated by ß-mercaptoethanol at an IgG:papain ratio of 100:1 (w/w) (Yamaguchi et al., 1994Go). Digestion of S25–2 was carried out in the presence of 1 mM DTT, 2 mM EDTA, and 15 mM Tris pH 8.5; the reaction mixture was brought to a final volume using 20 mM sodium acetate pH 5.4. Time trials established the optimal reaction time at 4 h after which time the reaction was quenched with iodoacetamide at a final concentration of 4 mM. The digest mixture was dialyzed against 20 mM sodium acetate pH 5.4. Fab fragments were separated by ion exchange HPLC using a Shodex CM-825 column (Phenomenex) in a mobile phase of 20 mM sodium acetate against a 0–1 M sodium chloride gradient. Fab fragments of the S25–23 IgG were prepared with mercuripapain (Sigma, #P-9886) activated by ß–mercaptoethanol (Yamaguchi et al., 1994Go). IgG and papain were added in a 200:1 (w/w) ratio in the presence of 0.5 mM DTT, 2 mM EDTA; the mixture was brought to a final volume with 50 mM Tris, 150 mM NaCl pH 8.0. After 4 h, the reaction was quenched with 23 mM iodoacetamide and dialyzed against 20 mM HEPES pH 7.5. The Fab fragments were separated by ion exchange HPLC using a CM-5PW column (Toshaas) in a mobile phase of 20 mM sodium acetate pH 3.8 against a 0–500 mM sodium chloride gradient. Both Fab fragments eluted as separate peaks which were collected, pooled and concentrated using Centricon 10 microconcentrators to final concentrations of ~3.5 mg/ml.

Surface plasmon resonance
The phenomenon of SPR originally observed by Otto (1968)Go and Kretschmann and Raether (1968)Go was used as a method for studying interactions of different forms of antibodies recognizing chlamydial lipopolysaccharide. Analyses were carried out using an automated BIACORE 1000 biosensor instrument (Biacore, Inc., Piscataway, NJ (Jönsson et al., 1991Go)). Neoglycoconjugates consisting of bovine serum albumin (BSA) linked, via a cysteamine spacer, to {alpha}–Kdo-monosaccharide, {alpha}-Kdo-(2->4)-{alpha}-Kdo-disaccharide, {alpha}-Kdo-(2->8)-{alpha}–Kdo-disaccharide, {alpha}-Kdo-(2->8)-{alpha}-Kdo-(2->4)-{alpha}-Kdo-trisaccharide, {alpha}-KdoC1red-(2->8)-{alpha}-Kdo-disaccharide, {alpha}–Kdo-(2->8)-{alpha}–KdoC1red-disaccharide, and {alpha}-Kdo-(2->8)-{alpha}-KdoC1red-(2->4)-{alpha}–Kdo-trisaccharide were immobilized on research grade CM5 sensor chips in 10 mM sodium acetate, pH 4.5, using the amine coupling kit supplied by the manufacturer. Unreacted moieties were blocked with ethanolamine. Control BSA surfaces were prepared in the same manner. All measurements were performed in 10 mM HEPES, pH 7.4, containing 150 mM NaCl, 3.4 mM EDTA and 0.005% Surfactant P-20 (Biacore, Inc.) at a flow rate of 10 or 50 µl/min. Surfaces were regenerated by normal dissociation or with 5 µl of 10 mM HCl and a contact time of 6 s. The amount of immobilized ligand on BSA was determined from the amount of Kdo in 1 mg/ml solutions of neoglycoconjugates. Kdo was determined by the thiobarbituric acid(TBA)-assay as described previously (Kaca et al., 1988Go). The concentration of BSA was determined using the Bradford-assay (Bio-Rad). Immediately prior to SPR-analysis, Fab and scFv preparations were subjected to size exclusion chromatography on Superdex 75 FPLC-column (Pharmacia Biotech) (Anand et al., 1991Go) to remove aggregated material and scFv dimers and higher oligomers. Concentrations of IgG, Fab, and scFv were assayed by adsorption at 280 nm on the basis of 1 mg/ml giving A280 = 1.35.

Because of low product yields by clones expressing scFv 25–23, purified preparations of the scFv were too dilute for spectrophotometric determination of concentration. In these instances, concentrations were determined by SPR monitoring of scFv binding to anti-c-myc surfaces under mass transport limiting conditions. Monomeric scFv of known concentration was used to prepare a standard curve using immobilized anti-c-myc antibody surfaces. Sensorgram data were analyzed using the BIAevaluation 3.0 software (Biacore, Inc.). Association and dissociation rate constants were derived by both separate and simultaneous fitting of the association and dissociation phases of individual sensorgrams. Sensorgrams were also fitted globally using data collected at a series of concentrations.


    Acknowledgments
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
We gratefully acknowledge the expert technical assistance of Ginette Dubuc in scFv assembly, Joseph Michniewicz in DNA sequencing, Tomoko Hirama in SPR analysis, Doris Bilous in V-gene isolation, Dave Watson in protein sequence analysis and Jinny Shaw in scFv production. We thank Dr. John Nash for the gift of vector pSJF8, Dr. Pierre Thibault for mass spectrometry and Perry Fleming and Lise Deschatelets for fermentation of bacteria. We thank the Deutsche Forschungs­gesellschaft (Grant SFB 470 projects A1 and C1), The Natural Sciences and Engineering Research Council of Canada and the National Research Council of Canada for financial support.


    Abbreviations
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
BSA, bovine serum albumin; CDR, complementarity determining region; Fab, fragment consisting of the antibody Fv and the first constant domain dimer; ka, association rate constant; kd, dissociation rate constant; KD, dissociation constant; Kdo, 3-deoxy-D-manno-oct-2-ulosonic acid; LPS, lipopolysaccharide; mAb, monoclonal antibody; scFv, single-chain Fv; SPR, surface plasmon resonance; RU, resonance unit.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 3. Alignment of S25–2 and S25–23 VH sequences with sequences from other murine monoclonal antibodies.

 

    Footnotes
 
1 To whom correspondence should be addressed at: Division of Biochemical and Medical Microbiology, Borstel Research Center, Parkallee 22, D-23845 Borstel, Germany Back


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
Anand,N.N., Mandal,S., MacKenzie,C.R., Sadowska,J., Sigurskjold,B., Young,N.M., Bundle,D.R. and Narang,S.A. (1991) Bacterial expression and secretion of various single-chain Fv genes encoding proteins specific for a Salmonella B O-antigen. J. Biol. Chem., 266, 21874–21879.[Abstract/Free Full Text]

Brade,H., Brabetz,W., Brade,L., Holst,O., Löbau,S., Lucakova,M., Mamat,U., Rozalski,A., Zych,K. and Kosma,P. (1997) Chlamydial lipopolysaccharide. J. Endotoxin Res., 4, 67–84.

Brade,L., Zych,K., Rozalski,A., Kosma,P., Bock,K. and Brade,H. (1997) Structural requirements of synthetic oligosaccharides to bind monoclonal antibodies against Chlamydia lipopolysaccharide. Glycobiology, 7, 819–827.[Abstract/Free Full Text]

Bundle,D.R., Cherwonogrodzki,J.W., Gidney,M.A., Meikle,P.J., Perry,M.B. and Peters,T. (1989) Definition of Brucella A and M epitopes by monoclonal typing reagents and synthetic oligosaccharides. Infect. Immun., 57, 2829–2836.[Abstract/Free Full Text]

Bundle,D.R. and Young,N.M. (1992) Carbohydrate-protein interactions in antibodies and lectins. Curr. Opin. Struct. Biol., 2, 666–673.

Burton,D.R. and Barbas III,C.F. (1994) Human antibodies from combinatorial libraries. Adv. Immunol., 57, 191–280.[Web of Science][Medline]

Caldwell,H.D. and Hitchcock,P.J. (1984) Monoclonal antibodies against a genus specific antigen of Chlamydia species: location of the epitope on chlamydial lipopolysaccharide. Infect. Immun., 44, 306–314.[Abstract/Free Full Text]

Collet,T.A., Roben,P., O’Kennedy,R., Barbas III,C.F., Burton,D.R. and Lerner,R.A. (1992) A binary plasmid system for shuffling combinatorial antibody libraries. Proc. Natl Acad. Sci. USA, 89, 10026–10030.[Abstract/Free Full Text]

Cooper,L.J., Shikhman,A.R., Glass,D.D., Kangisser,D., Cunningham,M.W. and Greenspan,N.S. (1993) Role of heavy chain constant domains in antibody-antigen interaction. J. Immunol., 150, 2231–2242.[Abstract]

Crews,S., Griffin,J., Huang,H., Calame,K. and Hood,L. (1981) A single VH gene segment encodes the immune response to phosphorylcholine: somatic mutation is correlated with the class of antibody. Cell, 25, 59–66.[Web of Science][Medline]

Cygler,M., Rose,D.R. and Bundle,D.R. (1991) Recognition of a cell surface oligosaccharide of pathogenic Salmonella by antibody Fab fragment. Science, 253, 442–445.[Abstract/Free Full Text]

Dinh,Q., Weng,N.P., Kiso,M., Ishida,H., Hasegawa,A. and Marcus,D.M. (1996) High-affinity antibodies against Lex and sialyl Lex from a phage display library. J. Immunol., 157, 732–738.[Abstract]

Emara,M.G., Tout,N., Kaushik,A. and Lam,J.S. (1995) Diverse VH and Vk genes encode antibodies to Pseudomonas aeruginosa LPS. J. Immunol., 155, 3912–3921.[Abstract]

Fu,Y., Baumann,M., Kosma,P., Brade,L. and Brade,H. (1992) A synthetic glycoconjugate representing the genus-specific epitope of chlamydial lipopolysaccharide exhibits the same specificity as its natural counterpart. Infect. Immun., 60, 1314–1321.[Abstract/Free Full Text]

Harris,S.L., Craig,L., Mehroke,J.S., Rashed,M., Zwick,M.B., Kenar,K., Toone,E.J., Greenspan,N., Auzanneau,F.I., Marino-Albernas,J.R., Pinto,B.M. and Scott,J.K. (1997) Exploring the basis of peptide-carbohydrate crossreactivity: evidence for discrimination by peptides between closely related anti-carbohydrate antibodies. Proc. Natl. Acad. Sci. USA, 94, 2454–2459.[Abstract/Free Full Text]

Hellström,I., Garrigues,H.J., Garrigues,U. and Hellström,K.E. (1990) Highly tumour-reactive, internalizing, mouse monoclonal antibodies to Le (y)-related cell surface antigens. Cancer Res., 50, 2183–2190.[Abstract/Free Full Text]

Jeffrey,P.D., Bajorath,J., Chang,C.Y., Yelton,D., Hellström,I., Hellström,K.E. and Sheriff,S. (1995) The X-ray struture of an anti-tumour antibody in complex with antigen. Nat. Struct. Biol., 2 (6), 466–471.

Jespers,C.S., Roberts,A., Mahler,S.M., Winter,G. and Hoogenboom,H.R. (1994) Guiding the selection of human antibodies from phage display repertoires to a single epitope of an antigen. BioTechnology, 12, 899–903.[Medline]

Jönsson,U., Fägestam,L., Ivarsson,B., Johnsson,B., Karlsson,R., Lundh,K., Löfås,S., Persson,B., Roos,H., Rönnberg,I., Sjölander,S., Stenberg,E., Ståhlberg,R., Urbaniczky,S., Östlin,H. and Malmqvist,M. (1991) Real-time biospecific interaction analysis using surface plasmon resonance and a sensor chip technology. Biotechniques, 11, 620–627.[Web of Science][Medline]

Kabat,E.A., Wu,T.T., Reid-Miller,M., Perry,H.M. and Gottesmann,U.S. (1987) Sequences of Immunological Interest. National Institutes of Health, Bethesda, MD.

Kaca,W., de Jongh-Leuvenink,J., Zähringer,U., Rietschel,E.Th., Brade,H., Verhoef,J. and Sinnwell,V. (1988) Iolation and chemical analysis of 7-O- (2-amino-2-deoxy-{alpha}- D-glucopyranosyl-L-glycero- D-manno-heptose as a constituent of the lipopolysaccharides of the UDP-galactose epimerase less mutant J-5 of Escherichia coli and Vibrio cholerae. Carbohydr. Res., 179, 289–299.[Web of Science][Medline]

Kaminski,M.J., MacKenzie,C.R., Moolibroek,M.J., Dahms,T.E.S., Hirama,T., Houghton,A.N., Chapman,P.B. and Evans,S.V. (1998) The role of homophilic binding in anti-tumor antibody R24 recognition of molecular surfaces. Demonstration of an intermolecular-sheet interaction between VH domains. J. Biol. Chem., 274, 5597–5604.[Abstract/Free Full Text]

Kang,A.S., Jones,T.M. and Burton,D.R. (1991) Antibody redesign by chain shuffling from random combinatorial immunoglobulin libraries. Proc. Natl. Acad. Sci. USA, 88, 11120–11123.[Abstract/Free Full Text]

Kretschmann,E. and Raether,H. (1968) Radiative decay of non radiative surface plasmons excited by light. Z. Naturforsch., 23, 2135–2136.

Lutz,C.T. and Davie,J.M. (1988) Genetics and primary structure of Vk gene segments encoding antibody to streptococcal group A carbohydrate. J. Immunol., 140, 641–645.[Abstract]

MacKenzie,C.R., Hirama,T., Deng,S., Bundle,D.R., Narang,S.A. and Young,N.M. (1996) Analysis by surface plasmon resonance of the influence of valence on the ligand binding affinity and kinetics of an anti-carbohydrate antibody. J. Biol. Chem., 271, 1527–1533.[Abstract/Free Full Text]

Martin,A., http://www.biochem.ucl.ac.uk/~martin/abs/index.html

Mikol,V., Kosma,P. and Brade,H. (1994) Crystal and molecular structure of allyl-O (sodium-3-deoxy-{alpha}-D-manno-2-octulopyranosylonate)- (2–8)-3-deoxy-{alpha}- D-manno-2-octulopyranosidonate)-monohydrate. Carbohydr. Res., 263, 35–42.

Moulder,J.W. (1991) Interaction of Chlamydiae and host cells in vitro. Microbiol. Rev., 55, 143–190.[Abstract/Free Full Text]

Myszka,D.G. (1997) Kinetic analysis of macromolecular interactions using surface plasmon resonance biosensors. Curr. Opin. Biotechnol., 8, 50–57.[Web of Science][Medline]

Nurminen,M., Leinonen,M., Saikku,P. and Mäkelä,P.H. (1983) The genus specific antigen of Chlamydia: resemblance to the lipopolysaccharide of enteric bacteria. Science, 220, 1279–1281.[Abstract/Free Full Text]

Otto,A. (1968) Excitation of nonradiative surface plasma waves in silver by the method of frustrated total reflection. Z. Phys., 216, 398–410.

Padlan,E.A. (1994) Anatomy of the antibody molecule. Mol. Immunol., 31, 169–217.[Web of Science][Medline]

Patenaude,S.I., Vijay,S.M., Yang,Q.L., Jennings,H.J. and Evans,S.V. (1998) Crystallization and preliminary x-ray diffraction analysis of antigen-binding fragments which are specific for antigenic conformations of sialic acid homopolymers. Acta Crystallogr. D Biol. Crystallogr., 54, 1005–1007.

Radic,M.Z., Masceli,M.A., Ericson,J., Shan,H. and Weigert,M. (1991) IgH and L chain contribution to autoimmune specificities. J. Immunol., 146, 176–182.[Abstract]

Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

Sato,C., Kitajima,K., Inoue,S., Seki,T., Troy,F.A., Inoue,Y. (1995) Characterization of the antigenic specificity of four different anti- ({alpha} 2->8-linked polysialicacid) antibodies using lipid-conjugated oligo/polysialic acids. J. Biol. Chem., 270, 18923–18928[Abstract/Free Full Text]

Scott,M.G., Crimmins,D.L., McCourt,D.W., Zocher,I., Thiebe,R., Zachau,H.G. and Nahm,M.H. (1989a) Clonal characterization of the human IgG antibody repertoire to Haemophilus influenzae type b polysaccharide. III. A single VkII gene and one of several Jk genes are joined by an invariant arginine to form the most common L chain V region. J. Immunol., 143, 4110–4116.[Abstract]

Scott,M.G., Tarrand,J.J., Crimmins,D.L., McCourt,D.W., Siegel,N.R., Smith,C.E. and Nahm,M.H. (1989b) Clonal characterization of the human IgG antibody repertoire to Haemophilus influenzae type b polysaccharide. II. IgG antibodies contain VH genes from a single VH family and VL genes from at least four VL families. J. Immunol., 293–298.

Smith-Gill,S.J., Hamel,P.A., Klein,M.H., Rudikoff,S. and Dorrington,K.J. (1986) Contribution of the Vk4 light chain to antibody specificity for lysozyme and ß- (1–6)-D-galactan. Mol. Immunol., 23, 919–926.[Web of Science][Medline]

Sokolowski,T., Haselhorst,T., Scheffler,K., Weisemann,R., Kosma,P., Brade,H., Brade,L. and Peters,T. (1998) Conformational analysis of a Chlamydia-specific disaccharide {alpha}-Kdo- (2–8)-{alpha}-Kdo- (2-O)-allyl in aqueous solution and bound to a monoclonal antibody—observation of intermolecular transfer NOEs. J. Biomol. NMR,

Vyas,N.K. (1991) Atomic features of protein carbohydrate interactions. Curr. Opin. Struct. Biol., 1, 732–740.

Yamaguchi,Y., Kim,H., Kato,K., Masuda,K., Shimada,I. and Arata,Y. (1994) Proteolytic fragmentation with high specificity of mouse immunoglobulin G. Mapping of proteolytic cleavage sites in the hinge region. J. Immunol. Methods, 181, 259–267.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
GlycobiologyHome page
C. Jin, M. Bencurova, N. Borth, B. Ferko, E. Jensen-Jarolim, F. Altmann, and B. Hantusch
Immunoglobulin G specifically binding plant N-glycans with high affinity could be generated in rabbits but not in mice
Glycobiology, April 1, 2006; 16(4): 349 - 357.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
S. Muller-Loennies, S. Gronow, L. Brade, R. MacKenzie, P. Kosma, and H. Brade
A monoclonal antibody against a carbohydrate epitope in lipopolysaccharide differentiates Chlamydophila psittaci from Chlamydophila pecorum, Chlamydophila pneumoniae, and Chlamydia trachomatis
Glycobiology, March 1, 2006; 16(3): 184 - 196.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (11)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Müller-Loennies, S.
Right arrow Articles by Narang, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Müller-Loennies, S.
Right arrow Articles by Narang, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?