Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (22)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Kingsley, P. D.
Right arrow Articles by Tabak, L. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kingsley, P. D.
Right arrow Articles by Tabak, L. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Glycobiology, 2000, Vol. 10, No. 12 1317-1323
© 2000 Oxford University Press

Diverse spatial expression patterns of UDP-GalNAc:polypeptide N-acetylgalactosaminyl-transferase family member mRNAs during mouse development

Paul D. Kingsley2,3, Kelly G.Ten Hagen2, Kathleen M. Maltby3, Jane Zara2 and Lawrence A. Tabak1,2

2Center for Oral Biology, Aab Institute of Biomedical Sciences, and 3Department of Pediatrics, University of Rochester, Rochester, NY 14642, USA

Received on May 13; revised on August 3, 2000; accepted on August 3, 2000.


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
Cell migration and adhesion during embryonic development are complex processes which likely involve interactions among cell-surface carbohydrates. While considerable work has implicated proteoglycans in a wide range of developmental events, only limited attention has been directed towards understanding the 7role(s) played by the related class of mucin-type O-glycans. The initial step of mammalian mucin-type O-glycosylation is catalyzed by a family of UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferases (ppGaNTases). The spatial expression patterns of the messenger RNAs of seven ppGaNTase family members were investigated from gastrulation through organogenesis stages of mouse development. The seven glycosyltransferases were expressed in unique patterns during embryogenesis. ppGaNTase-T1, -T2, -T4, and –T9 were expressed more ubiquitously than ppGaNTase-T3, -T5, and -T7. Organ systems with discrete accumulation patterns of ppGaNTase family members include the gastrointestinal tract (intestine, liver, stomach, submandibular gland), nervous system (brain, eye), lung, bone, yolk sac, and developing craniofacial region. The pattern in the craniofacial region included differential expression by family members in developing mandible, teeth, tongue and discrete regions of the brain including the pons and migratory, differentiating neurons. Additionally, ppGaNTase-T5 accumulates in a subset of mesenchymal cells at the ventral-most portions of the E12.5 maxilla and mandible underlying the dental lamina. The unique spatiotemporal expression of the different ppGaNTase family members during development suggests unique roles for each of these gene products.

Key words: O-glycosylation/mouse development/in situ hybridization/ UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferases/epithelial-mesenchymal interactions


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
Cell surface carbohydrates undergo marked changes during mammalian development (for review, see Feizi, 1985Go; Muramatsu, 1988Go; Bourrillon and Aubery, 1989Go; Fenderson et al., 1990Go; Poirier and Kimber, 1997Go; Zschabitz, 1998Go). Based largely on the temporal and spatial pattern of oligosaccharide expression observed, it has been speculated that carbohydrates are involved in such diverse processes as cell activation, adhesion, differentiation, migration, and tissue morphogenesis.

Prior work has focused largely on the roles played by N-linked glycans during development. Tunicamycin, an inhibitor of N-linked glycosylation, disrupts gastrulation of sea urchins (Heifetz and Lennarz, 1979Go) and compaction and blastocyst formation in mice (Surani, 1979Go; Atienza-Samols et al., 1980Go). Changes in the expression or activity of glycosyltransferases during ontogeny have been documented (e.g., Armant et al., 1986Go; Granovsky et al., 1995Go; Ong et al., 1998Go; Fan et al., 1999Go; Liu et al., 1999Go). Inactivation of mouse gene Mgat1, which encodes the glycosyltransferase required to convert N-linked oligosaccharides from high-mannose precursors to their complex forms, resulted in embryonic lethality by day 10.5 (Ioffe and Stanley, 1994Go; Metzler et al., 1994Go). To circumvent the early embryonic lethal phenotype, Ioffe et al. (1996)Go followed embryonic stem cells with an inactivated Mgat1 allele in chimeric embryos. They determined that the mutated cells did not contribute to the formation of an organized layer of bronchial epithelium, leading to the speculation that complex N-glycans are required for some aspect of cell–cell recognition during the epithelialization of the lung. Mutant embryos were underdeveloped and displayed cellular disorganization of many tissues, but the timing of death, and the phenotype are most consistent with lethality due to a vascular or circulatory defect.

Recently, the role of proteoglycans in development has been explored in genetically tractable organisms (Perrimon and Bernfield, 2000Go). Cell surface heparan proteoglycans have been demonstrated to be essential for normal fibroblast growth factor (FGF) receptor signaling during development of Drosophila. Mutation in either the sugarless (sgl) or sulfateless (sfl) genes results in defects in the migration of mesodermal and tracheal cells during embryogenesis (Lin et al., 1999Go). These genes encode UDP-glucose dehydrogenase (which is required for the formation of glucuronic acid) and heparin/heparan sulfate N-deacetylase/N-sulfotransferase respectively (specifically needed for formation of heparan sulfate). A recent study has identified the division abnormally delayed (dally) gene as a putative substrate for these enzymes (Lin et al., 1999Go); dally encodes a glycosyl-phosphatidyl inositol (GPI)-linked glypican.

The products of three genes, sqv-3, sqv-7, and sqv-8, are required for proper vulval invagination in C.elegans (Herman and Horvitz, 1999Go). The protein product of sqv-3 is related to vertebrate ß1,4 galactosyltransferases; the predicted protein product of sqv-8 appears to encode a ß1,3 glucuronyltransferase; and the protein product of sqv-7 is similar to a family of nucleotide-sugar transporters. It is proposed that the sqv genes encode components of a glycosyltransferase pathway that are required to assemble a saccharide necessary for vulval invagination.

Other forms of O-glycans appear to play a role during metazoan development. Mutations in the rotated abdomen (rt) locus in Drosophila melanogaster affect muscle development and caused a clockwise helical rotation of the body (Martin-Blanco and Garcia-Bellido, 1996Go). The rt gene encodes a protein which has extensive homology to the yeast proteins PMT1 and PMT2 which are known O-mannosyltransferases. Recently, the human orthologue of the rt gene, POMT1, was identified and RNA blot analysis showed the transcript encoding the product of this gene was highly expressed in heart and skeletal muscle (Jurado et al., 1999Go). {alpha}-dystroglycan, which is part of the dystrophin–glycoprotein complex of muscle, has recently been demonstrated to be decorated with O-mannosyl-containing oligosaccharides (Chiba et al., 1997Go). Based on inhibition studies, the O-mannosylated oligosaccharides have been implicated in {alpha}-dystroglycan-laminin interactions. Thus one possibility is that the disruption of the rt locus leads to a loss of O-mannosylation of muscle complex glycoproteins, thereby compromising muscle and body development.

In higher eukaryotes, mucin type O-glycosylation is a posttranslational event in which oligosaccharides are built step-wise. A family of enzymes, termed UDP-GalNAc:polypeptide N-Acetylgalactosaminyltransferases (ppGaNTases, EC 2.4.1.41) is responsible for the initiation of O-glycosylation; N-acetylgalactosamine (GalNAc) is transferred from the sugar donor, UDP-GalNac, in {alpha} anomeric linkage to a serine or threonine of the polypeptide backbone (GalNAc {alpha}1-O-Ser/Thr). As an initial step to understand the potential roles in which this enzyme family is involved in development, we have investigated the expression pattern of seven ppGaNTases using in situ hybridization to mRNAs with in vitro transcribed, transcript-specific RNA probes. All family members whose function had been validated when these studies were initiated were chosen for examination (ppGaNTase-T1, -T2, -T3, -T4, -T5, -T7, and -T9). Several stages during murine development were studied to determine the expression patterns during development in a variety of organ systems. We show that the ppGaNTases examined each accumulate in an unique spatial and temporal pattern. These patterns indicate that this gene family may be involved in the development of multiple organ systems characterized by epithelial/mesenchymal interactions during their organogenesis. Additionally, several ppGaNTases are expressed in unique patterns in the brain, indicating involvement in development of nervous tissue.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
Overview of expression of ppGaNTase mRNA expression during mouse embryogenesis
ppGaNTase message accumulation varies in abundance for different family members at the end of gastrulation (E7.5) but is widespread in both the embryo proper and extraembryonic tissues when detected (ppGaNTase-T3 and –T5 are not detected until later in embryogenesis). When detected, the strongest signals for any of the ppGaNTase family members would be considered to be moderately abundant (i.e. <= 0.03% of poly A+ RNA; see Lasky et al., 1980Go). Throughout organogenesis, there are two general patterns observed for the different gene transcripts: ubiquitous and discrete (Figure 1). The most ubiquitous expression is observed for ppGaNTase -T1, -T2, and –T9, with the most discreet expression observed for ppGaNTase-T5 and -T7. As embryogenesis proceeds, there is a tendency for the more ubiquitously expressed messages to become more tissue specific.



View larger version (65K):
[in this window]
[in a new window]
 
Fig. 1. Overview of expression of ppGaNTase family members during development. mRNA accumulation patterns for seven ppGaNTase family members (-T9, -T1, -T2, -T3, -T4, -T5, -T7, indicated at left) are presented at four times of embryonic development. Column A shows E7.5, late streak to early neural plate stage, Theiler stage 10–11; column B shows E12.5, Theiler stage 21; column C shows E14.5, Theiler stage 22–23, and column D shows E16.5, Theiler stage 25. Message intensity (red) is overlaid on tissue (blue). See Materials and methods for imaging details. Size bar in A represents 100 µM, in B represents 250 µM, and in C, D represents 1000 µM. BF, Brightfield; ys, yolk sac; ep, embryo proper; m, mandible; li, liver; lu, lung; I, intestine; sm, submandibular gland; e, eye.

 
As indicated in Figure 1, at mid- to late gestation (E12.5–E16.5), moderate signals for transcripts were detected in nervous tissues (ppGaNTase-T1, -T2, and -T7; Figure 2), neural crest cells (ppGaNTase-T1 and –T9) and tongue (ppGaNTase-T1, -T2, T4, -T5, and -T9). Transcript accumulation was also prominent in the dental mesenchyme (ppGaNTase-T5, and -T9; Figure 3), the lung (ppGaNTase-T1, -T2, -T3; Figure 4) as well as the epithelium of whisker follicles (ppGaNTase-T1, -T9; Figure 3), and intestine (in which all family members are expressed; Figure 5). All family members are additionally detected in the developing submandibular/sublingual salivary gland (Figure 6).



View larger version (112K):
[in this window]
[in a new window]
 
Fig. 2. ppGaNTase expression in the developing central nervous system at E12.5, Theiler stage 21. (A) and (B) show expression of ppGaNTase-T1 at E12.5. (C) and (D) show expression of ppGaNTase-T2 at E12.5. (E) and (F) show expression of ppGaNTase-T7 at E12.5. Scale bars: (A) 1 mM, (B) 500 µM. fb, Forebrain; mb, midbrain; hb, hindbrain; hy, hypothalamus; lt, lamina terminalis; cp, choroid plexus.

 


View larger version (116K):
[in this window]
[in a new window]
 
Fig. 3. ppGaNTase expression in the developing mandible and maxilla. (A) and (B) show expression of ppGaNTase-T5 in E12.5 (Theiler stage 21) mandible and maxilla. (C, E, G) are brightfield, and (D, F, H) are pseudocolored brightfield/darkfield overlays of ppGaNTase expression in E14.5 (Theiler stage 22–23) maxillae. See Materials and methods for imaging details. (C, D) are ppGaNTase-T9, (E, F) are ppGaNTase-T1, and (G, H) are ppGaNTase-T2. E, Epithelium; m, mesenchyme; fv, follicles of vibrissae. Scale bars: (A) 1 mm, (B and C) 250 µM.

 


View larger version (173K):
[in this window]
[in a new window]
 
Fig. 4. ppGaNTase expression in E14.5 (Theiler stage 22–23) lung. (A, C, E) are brightfield, and (B, D, F) are pseudocolored brightfield/darkfield overlays. See Materials and methods for imaging details. (A, B) are ppGaNTase-T1; (C, D) are ppGaNTase-T2; (E, F) are ppGaNTase-T3. B, Bronchus. Size bar in (A), 100 µM.

 


View larger version (137K):
[in this window]
[in a new window]
 
Fig. 5. ppGaNTase expression in E16.5 intestine. (A) Negative control, (B) ppGaNTase-T1, (C) ppGaNTase-T2, (D) ppGaNTase-T7. V, Villus; m, muscle. Scale bar, 100 µM.

 


View larger version (184K):
[in this window]
[in a new window]
 
Fig. 6. ppGaNTase expression in E16.5 submandibular/sublingual gland. (A, C, E) are brightfield, and (B, D, F) are pseudocolored brightfield/darkfield overlays. See Materials and methods for imaging details. (A, B) are ppGaNTase-T2; (C, D) are ppGaNTase-T7; (E, F) are ppGaNTase. Large arrowheads indicate duct cells and small triangles indicate acinar cells. Scale bar, 250 µM.

 
Differential expression of ppGaNTase messages in nervous tissues
mRNAs encoding ppGaNTase -T1 and -T2 accumulate in similar patterns in the E12.5 brain (Figure 2). Expressing tissues include the floor of the forebrain, midbrain, and hindbrain. The cells of the proliferating ventricular zone express the highest levels of these messages (Figure 2D). In contrast, ppGaNTase-T7 expression is absent in these tissues, but accumulates in the developing lamina terminalis and choroid plexus, both of which will be secretory structures of the central nervous system (Figure 2). There are marked differences in the expression of the developing eye at E16.5. ppGaNTase-T1 is expressed in the pigment layer of the retina, ppGaNTase-T2 is localized throughout the lens, and ppGaNTase-T9 accumulates in the cornea, the cuboidal epithelium of the lens, and the neural layer of the retina (Figure 1, and not shown).

Expression of ppGaNTases in developing tooth and mandible
ppGaNTase-T5 message accumulates specifically in a subset of mesenchyme at E12.5 when that tissue contains odontogenic potential (Figure 3A,B). Serial section analysis indicates expressing cells include subsets of both dental and non-dental mesenchyme (not shown). ppGaNTase-T5 expressing cells are located where a subset of cells of neural crest origin are at this stage (Chai et al., 2000Go). At E14.5, ppGaNTase-T5 expression is markedly reduced and ppGaNTase-T9 mRNA accumulates in neural crest cells destined to become both bone and tooth in the mandible. In contrast, ppGaNTase-T1 accumulates at higher levels in the subset of neural crest cells forming the bone, but not the tooth of the mandible (Figure 3F). The expression patterns of ppGaNTase-T9 and ppGaNTase-T1 are more spatially restricted in the developing tooth and mandible than ppGaNTase-T2 (Figure 3H and Figure 1).

Expression of ppGaNTase mRNAs in other organ systems in which epithelial–mesenchymal interactions occur during development
pGaNTase-T1 accumulates in most cell types in the developing lung except airway epithelial cells of the segmented bronchi (Figure 4). ppGaNTase-T2 is more restricted to mesenchymal cells, whereas ppGaNTase-T3 is expressed in a small subset of cells whose location is consistent with neural epithelial bodies (Figure 4). All seven ppGaNTase family members examined were expressed in E16.5 intestinal epithelial cells, although at varying abundance (Figure 5 and Figure 1, E16.5). Only ppGaNTase-T2 was additionally expressed in the smooth muscle layer (Figure 5C). Similarly, expression of all seven ppGaNTases examined was detected at varying levels in E16.5 submandibular/sublingual salivary gland (Figure 6 and Figure 1, E16.5). ppGaNTase-T2 is expressed abundantly in both acinar cells and duct cells (Figure 6B). ppGaNTase-T7 and -T9 are expressed predominantly in acinar cells (Figure 6D and 6F).


    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
The expression of ppGaNTase mRNAs was found to be strictly regulated both spatially and temporally in an isoform-specific manner during mouse embryogenesis. In several instances the expression of the ppGaNTases is restricted to either the mesenchymal or epithelial tissue during the morphogenesis of an organ being guided by mesenchymal/epithelial interactions. In no instance however did we observe simultaneous expression of a specific ppGaNTase isoform in both tissue types during organ differentiation. We speculate that this relates to the formation of some ligand/receptor complex that is required for organogenesis which segregates between the two tissue types of the mesenchymal–epithelial interface.

The overall pattern of expression for this family of enzymes strongly indicates that ppGaNTases are not merely involved in the biosynthesis of mucin-glycoproteins as an end-product for an organ. For example, while all isoforms are clearly expressed in developing submandibular gland by E16.5 (corresponding to Theiler stage 25), the quantity of salivary mucin at this stage of development accounts for only 0.01% of the total gland protein. This is in contrast to the adult gland in which the mucin makes up 1.2% of the total protein (Denny et al., 1989Go). Thus, it is likely that this enzyme family is responsible for the synthesis of other O-glycans at this stage of development.

Cranial neural crest cells contribute to a variety of tissues including the intramembranous bones of the craniofacial complex and portions of the teeth (Le Douarin, 1982Go; Chai et al., 2000Go) Peanut agglutinin (PNA), a lectin which specifically recognizes the mucin core disaccharide Galß1,3 GalNAc (Lotan et al., 1975Go), has been used in numerous studies to probe for the presence of O-glycans during development. In Drosophila, peanut agglutinin labels the developing nervous system (Callaerts et al., 1995Go). Later in Drosophila development peanut agglutinin also reacts with the lumen of the hindgut, salivary glands, and the Malpighian tubules (Callaerts et al., 1995Go). No evidence for either fucose or sialic acid was observed in developing Drosophila. In contrast, peanut agglutinin fails to stain condensing mesenchyme associated with either developing nasal cartilage or Meckel’s cartilage within the mandible (Sasano et al., 1992Go; Zschabitz et al., 1995Go) of developing mice. However, following neuraminidase digestion, several studies report PNA reactivity in these developing craniofacial structures (Slack, 1985Go; Louryan and Glineur, 1991Go; Zschabitz et al., 1995Go; Miyake et al., 1996Go; as cited in Zschabitz, 1998Go). Presumably, one or more of the ppGaNTases localized to neural crest cells and other developing structures observed in the present study are involved in the assembly of O-glycans. The future challenge lies in identifying the substrates which are decorated with O-glycans and then determining what functional role each glycosylated substrate plays during embryogenesis.


    Materials and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
Molecular probes
All vectors were linearized at the introduced HindIII site and transcribed with T7 RNA polymerase to produce labeled antisense RNA, or linearized with XhoI for T3 RNA polymerase transcription to produce sense control probes. Control probes indicated no specific hybridization patterns.

ppGaNTase-T1 transcripts were detected using the plasmid pBSmT1-IS. pBSmT1-IS contains nucleotides 1376–1676 of the mouse ppGaNTase-T1 amino acid coding region generated by PCR amplification using the primers mT1insitu+ (d(ATAGGTACCAAGCTTGTCATGGTATGGGAGGTAATCAGG)) and mT1insitu- (d(ATAGAGCTCGAGAATATTTCTGGAAGGGTGACAT)); the PCR product was cloned into the KpnI and SacI sites of pBluescript KS+.

ppGaNTase-T2 transcripts were detected using the plasmid pBSmT2-IS. pBSmT2-IS contains nucleotides 1365–1670 of the mouse T2 amino acid coding region. It was generated by PCR amplification using primers mT2IS-S (d(ATAGGTACCAAGCTTCTGCCTCGACACTTTGGGACACT)) and mT2IS-AS (d(ATAGAGCTCGAGGCCACACACCTCCACGCTTAGGC)); the PCR product was cloned into the KpnI and SacI sites of pBluescript KS+.

ppGaNTase-T3 transcripts were detected using the plasmid pBSmT3-IS. pBSmT3-IS contains nucleotides 1633–1874 of the mouse T3 amino acid coding region (Zara et al., 1996Go). It was generated by PCR amplification using primers mT3insitu(2)+ (d(ATAGGTACCAAGCTTCGAGTATTCTGCTCAGCGTGAA)) and mT3insitu (2)- (d(ATAGAGCTCGAGTTGGAGTAGATCTGTTGCGTCAT)); the PCR product was cloned into the KpnI and SacI sites of pBluescript KS+.

ppGaNTase-T4 transcripts were detected using the plasmid pBSmT4-IS. pBSmT4-IS contains nucleotides 1483–1714 of the mouse T4 amino acid coding region (Hagen et al., 1997Go). It was generated by PCR amplification using primers mT4IS+ (d(ATAGGTACCAAGCTTCAGATTCAATTCCGTGACTGAA)) and mT4IS-(d(ATAGAGCTCGAGCTGGTTTTTATCAAGGGCATC)); the PCR product was cloned into the KpnI and SacI sites of pBluescript KS+.

ppGaNTase-T5 transcripts were detected using the plasmid pBSmTB-IS. pBSmTB-IS contains a 212 bp region of the mouse T5 cDNA corresponding to nucleotides 2542–2754 of the rat T5 amino acid coding region (Ten Hagen et al., 1998Go). It was generated by PCR amplification using primers mTBKelIS-S (d(ATAGGTACCAAGCTTGTGTGGCGCCCATCCCTGATA)) and mTBKelIS-AS (d(ATAGAGCTCGAGGTGGTTCCGTCGGGTTACAAGCAG)); the PCR product was cloned into the KpnI and SacI sites of pBluescript KS+.

ppGaNTase-T7 transcripts were detected using the plasmid pBSrT7-IS. pBSrT7-IS contains nucleotides 1759–1964 of the rat T7 gene (Ten Hagen et al., 1999Go). It was generated by PCR amplification using primers mT5IS+ (d(ATAGGTACCAAGCTTGACCAAGGGACCCGACGGATCC) and mT5IS- (d(ATAGAGCTCGAGGATGTTATTCATCTCCCACTTCT-GAT); the PCR product was cloned into the KpnI and SacI sites of pBluescript KS+.

ppGaNTase-T9 transcripts were detected using the plasmid pBSrTa-IS. pBSrTa-IS contains nucleotides 199–381 of the rat ppGaNTase-T9 amino acid coding region (Ten Hagen et al., unpublished observations). It was generated by PCR amplification using the primers mTAIS+ (d(ATAGGTACCAAGCTTGCTGAACAAAGGCTGAAGGA) and mTAIS- (d(ATAGAGCTCGAGAGAGCGATTCAGGGAGATT); the PCR product was cloned into the KpnI and SacI sites of pBluescript KS+.

Single-stranded RNA antisense and sense 33P-labeled probes were prepared with specific activities of 4–5 x 109 d.p.m./µg.

In situ hybridization
In situ hybridization was performed using a modification of procedures described by Wilkinson and Green (1990)Go, and as described by McGrath et al. (1999)Go. Embryos were collected from outbred ICR mice (Taconic, Germantown, NY) strain. Noon the day vaginal plugs were detected was designated as day 0.5 of gestation, post coitus (pc). Mice were anesthetized with C02 prior to cervical dislocation. Mouse embryos were fixed overnight in freshly prepared ice cold 4% paraformaldehyde in PBS. The embryos were dehydrated through ethanol into xylene and embedded in paraffin using a Tissue-Tek V.I.P. automatic processor (Miles, Mishawaka, IN). Sections (5 µm) were adhered to commercially modified glass slides (Super Frost Plus, VWR, Rochester, NY), dewaxed in xylene, rehydrated through graded ethanols, treated with proteinase K to enhance probe accessibility and with acetic anhydride to reduce nonspecific background. Sections were hybridized with probes at Tm- 15°C, washed at high stringency (Tm- 7°C) and treated with RNase A to further diminish non-specific adherence of probe. Autoradiography with NBT-2 emulsion (Eastman Kodak, Rochester, NY) was performed for 25 days. Slides were developed with D19 (Eastman Kodak), and the tissue counterstained with hematoxylin. Brightfield and darkfield grayscale images were captured with a Polaroid Digital Microscope camera (Polaroid, Cambridge, MA) and processed using Adobe Photoshop (Adobe Systems, San Jose, CA) with Image Processing Toolkit (Reindeer Games, Asheville, NC). Darkfield images were pseudocolored red and overlaid on brightfield images which were pseudocolored blue.


    Acknowledgments
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
This work was supported in part by USPHS Grant DE08108. (to L.A.T.).


    Abbreviations
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
ppGaNTases, UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferases; E7.5, embryonic day post coitus day 7.5; PCR, polymerase chain reaction; RNA, ribonucleic acid; Tm, temperature at which 50% of hybrids become single-stranded; d.p.m., disintegrations per minute.


    Footnotes
 
1 To whom correspondence should be addressed at: NIDCR-NIH, 31 Center Drive MSC 2290, Building 31, Room 2C39, Bethesda, MD 20892 Back


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
Armant,D.R., Kaplan,H.A. and Lennarz,W.J. (1986) N-Linked glycoprotein biosynthesis in the developing mouse embryo. Dev. Biol., 113, 228–237.

Atienza-Samols,S.B., Pine,P.R. and Sherman,M.I. (1980) Effects of tunicamycin upon glycoprotein synthesis and development of early mouse embryos. Dev. Biol., 79, 19–32.

Bourrillon,R. and Aubery,M. (1989) Cell surface glycoproteins in embryonic development. Int. Rev. Cytol., 116, 257–338.

Callaerts,P., Vulsteke,V., Peumans,W. and Deloof,A. (1995) Lectin-binding sites during Drosophila embryogenesis. Rouxs Arch. Dev. Biol., 204, 229–243.

Chai,Y., Jiang,X., Ito,Y., Bringas,P.,Jr., Han,J., Rowitch,D.H., Soriano,P., McMahon,A.P. and Sucov,H.M. (2000) Fate of the mammalian cranial neural crest during tooth and mandibular morphogenesis. Development, 127, 1671–1679.

Chiba,A., Matsumura,K., Yamada,H., Inazu,T., Shimizu,T., Kusunoki,S., Kanazawa,I., Kobata,A. and Endo,T. (1997) Structures of sialylated O-linked oligosaccharides of bovine peripheral nerve alpha-dystroglycan. The role of a novel O-mannosyl-type oligosaccharide in the binding of alpha-dystroglycan with laminin. J. Biol. Chem., 272, 2156–2162.

Denny,P.A., Pimprapaiporn,W., Bove,B.J., Kim,M.S. and Denny,P.C. (1989) Appearance of acinar-cell-specific mucin in prenatal mouse submandibular glands. Differentiation, 40, 93–98.

Fan,Q.W., Uchimura,K., Yuzawa,Y., Matsuo,S., Mitsuoka,C., Kannagi,R., Muramatsu,H., Kadomatsu,K. and Muramatsu,T. (1999) Spatially and temporally regulated expression of N-acetylglucosamine-6-O-sulfotransferase during mouse embryogenesis. Glycobiology, 9, 947–955.

Feizi,T. (1985) Demonstration by monoclonal antibodies that carbohydrate structures of glycoproteins and glycolipids are onco-developmental antigens. Nature, 314, 53–57.

Fenderson,B.A., Eddy,E.M. and Hakomori,S. (1990) Glycoconjugate expression during embryogenesis and its biological significance. Bioessays, 12, 173–179.

Granovsky,M., Fode,C., Warren,C.E., Campbell,R.M., Marth,J.D., Pierce,M., Fregien,N. and Dennis,J.W. (1995) GlcNAc-transferase V and core 2 GlcNAc-transferase expression in the developing mouse embryo. Glycobiology, 5, 797–806.

Hagen,F.K., Ten Hagen,K.G., Beres,T.M., Balys,M., VanWuyckhuyse,B.C. and Tabak,L.A. (1997) cDNA cloning and expression of a novel UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase. J. Biol. Chem., 272, 13843–13848.

Heifetz,A. and Lennarz,W.J. (1979) Biosynthesis of N-glycosidically linked glycoproteins during gastrulation of sea urchin embryos. J. Biol. Chem., 254, 6119–6127.

Herman,T. and Horvitz,H.R. (1999) Three proteins involved in Caenorhabditis elegans vulval invagination are similar to components of a glycosylation pathway. Proc. Natl. Acad. Sci. USA, 96, 974–979.

Ioffe,E. and Stanley,P. (1994) Mice lacking N-acetylglucosaminyltransferase I activity die at mid-gestation, revealing an essential role for complex or hybrid N-linked carbohydrates. Proc. Natl. Acad. Sci. USA, 91, 728–732.

Ioffe,E., Liu,Y. and Stanley,P. (1996) Essential role for complex N-glycans in forming an organized layer of bronchial epithelium. Proc. Natl. Acad. Sci. USA, 93, 11041–11046.

Jurado,L.A., Coloma,A. and Cruces,J. (1999) Identification of a human homolog of the Drosophila rotated abdomen gene (POMT1) encoding a putative protein O-mannosyl-transferase and assignment to human chromosome 9q34.1. Genomics, 58, 171–180.

Lasky,L.A., Lev,Z., Xin,J.H., Britten,R.J. and Davidson,E.H. (1980) Messenger RNA prevalence in sea urchin embryos measured with cloned cDNAs. Proc. Natl. Acad. Sci. USA, 77, 5317–5321.

Le Douarin,N. (1982) The Neural Crest. Cambridge University Press, New York.

Lin,X.H., Buff,E.M., Perrimon,N. and Michelson,A.M. (1999) Heparan sulfate proteoglycans are essential for FGF receptor signaling during Drosophila embryonic development. Development, 126, 3715–3723.

Liu,N., Jin,C., Zhu,Z.M., Zhang,J.N., Tao,H., Ge,C.H. and Yang,S.J. (1999) Stage-specific expression of {alpha} 1,2-fucosyltransferase and {alpha} 1,3-fucosyltransferase (FT) during mouse embryogenesis. Eur. J. Biochem., 265, 258–263.

Lotan,R., Skutelsky,E., Danon,D. and Sharon,N. (1975) The purification, composition and specificity of the anti-T lectin from peanut (Arachis hypogaea). J. Biol. Chem., 250, 8518–8523.

Louryan,S. and Glineur,R. (1991) Lectin histochemistry in the developing oto-maxillo-facial primordia of the mouse embryo. Bull. Group Int. Rech. Sci. Stomatol. Odontol., 34, 79–87.

Martin-Blanco,E. and Garcia-Bellido,A. (1996) Mutations in the rotated abdomen locus affect muscle development and reveal an intrinsic asymmetry in Drosophila. Proc. Natl. Acad. Sci. USA, 93, 6048–6052.

McGrath,K.E., Koniski,A.D., Maltby,K.M., McGann,J.K. and Palis,J. (1999) Embryonic expression and function of the chemokine SDF-1 and its receptor, CXCR4. Dev. Biol., 213, 442–456.

Metzler,M., Gertz,A., Sarkar,M., Schachter,H., Schrader,J.W. and Marth,J.D. (1994) Complex asparagine-linked oligosaccharides are required for morphogenic events during post-implantation development. EMBO J., 13, 2056–2065.

Miyake,T., Cameron,A.M. and Hall,B.K. (1996) Stage-specific onset of condensation and matrix deposition for Meckel’s and other first arch cartilages in inbred C57BL/6 mice. J. Craniofac. Genet. Dev. Biol., 16, 32–47.

Muramatsu,T. (1988) Alterations of cell-surface carbohydrates during differentiation and development. Biochimie, 70, 1587–1596.

Ong,E., Nakayama,J., Angata,K., Reyes,L., Katsuyama,T., Arai,Y. and Fukuda,M. (1998) Developmental regulation of polysialic acid synthesis in mouse directed by two polysialyltransferases, PST and STX. Glycobiology, 8, 415–424.

Perrimon,N. and Bernfield,M. (2000) Specificities of heparan sulphate proteoglycans in developmental processes. Nature, 404, 725–728.

Poirier,F. and Kimber,S. (1997) Cell surface carbohydrates and lectins in early development. Mol. Hum. Reprod., 3, 907–918.

Sasano,Y., Kaji,Y., Nakamura,M., Kindaichi,K., Slavkin,H.C. and Kagayama,M. (1992) Distribution of glycoconjugates localized by peanut and Maclura pomifera agglutinins during mouse molar root development. Acta Anat., 145, 149–155.

Slack,J.M. (1985) Peanut lectin receptors in the early amphibian embryo: regional markers for the study of embryonic induction. Cell, 41, 237–247.

Surani,M.A. (1979) Glycoprotein synthesis and inhibition of glycosylation by tunicamycin in preimplantation mouse embryos: compaction and trophoblast adhesion. Cell, 18, 217–227.

Ten Hagen,K.G., Hagen,F.K., Balys,M.M., Beres,T.M., VanWuyckhuyse,B.C. and Tabak,L.A. (1998) Cloning and expression of a novel, tissue-specific expressed member of the UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase family. J. Biol. Chem., 273, 27749–27754.

Ten Hagen,K.G., Tetaert,D., Hagen,F.K., Richet,C., Beres,T.M., Gagnon,J., Balys,M.M., VanWuyckhuyse,B., Bedi,G.S., Degand,P. and Tabak,L.A. (1999) Characterization of a UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase that displays glycopeptide N- acetylgalactosaminyltransferase activity. J. Biol. Chem., 274, 27867–27874.

Wilkinson,D.G. and Green,J. (1990) In situ hybridization and the three-dimensional reconstruction of serial sections. In Copp,A.J. and Cockroft,D.L. (eds.), Postimplantation Mammalian Embryos. A Practical Approach. IRL Press, New York, pp. 155–171.

Zara,J., Hagen,F.K., Ten Hagen,K.G., Van Wuyckhuyse,B.C. and Tabak,L.A. (1996) Cloning and expression of mouse UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase-T3. Biochem. Biophys. Res. Commun., 228, 38–44.

Zschabitz,A. (1998) Glycoconjugate expression and cartilage development of the cranial skeleton. Acta Anat., 161, 254–274.

Zschabitz,A., Weiser,H., Stofft,E., Krahn,V., Gabius,H.J., Khaw,A. and Biesalski,H.K. (1995) Characterization of glycoconjugate expression during development of Meckel’s cartilage in the rat. Anat. Embryol. (Berlin), 191, 47–49.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
L. Zhang, Y. Zhang, and K. G. T. Hagen
A Mucin-type O-Glycosyltransferase Modulates Cell Adhesion during Drosophila Development
J. Biol. Chem., December 5, 2008; 283(49): 34076 - 34086.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Tenno, K. Ohtsubo, F. K. Hagen, D. Ditto, A. Zarbock, P. Schaerli, U. H. von Andrian, K. Ley, D. Le, L. A. Tabak, et al.
Initiation of Protein O Glycosylation by the Polypeptide GalNAcT-1 in Vascular Biology and Humoral Immunity
Mol. Cell. Biol., December 15, 2007; 27(24): 8783 - 8796.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
E Tian and K. G T. Hagen
O-linked glycan expression during Drosophila development
Glycobiology, August 1, 2007; 17(8): 820 - 827.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
E. Tian and K. G. Ten Hagen
Expression of the UDP-GalNAc : polypeptide N-acetylgalactosaminyltransferase family is spatially and temporally regulated during Drosophila development
Glycobiology, February 1, 2006; 16(2): 83 - 95.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E Tian, K. G. T. Hagen, L. Shum, H. C. Hang, Y. Imbert, W. W. Young Jr, C. R. Bertozzi, and L. A. Tabak
An Inhibitor of O-Glycosylation Induces Apoptosis in NIH3T3 Cells and Developing Mouse Embryonic Mandibular Tissues
J. Biol. Chem., November 26, 2004; 279(48): 50382 - 50390.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
L. Xia, T. Ju, A. Westmuckett, G. An, L. Ivanciu, J. M. McDaniel, F. Lupu, R. D. Cummings, and R. P. McEver
Defective angiogenesis and fatal embryonic hemorrhage in mice lacking core 1-derived O-glycans
J. Cell Biol., February 2, 2004; 164(3): 451 - 459.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Zhang, H. Iwasaki, H. Wang, T. Kudo, T. B. Kalka, T. Hennet, T. Kubota, L. Cheng, N. Inaba, M. Gotoh, et al.
Cloning and Characterization of a New Human UDP-N-Acetyl-alpha -D-galactosamine:Polypeptide N-Acetylgalactosaminyltransferase, Designated pp-GalNAc-T13, That Is Specifically Expressed in Neurons and Synthesizes GalNAc alpha -Serine/Threonine Antigen
J. Biol. Chem., January 3, 2003; 278(1): 573 - 584.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
K. G. Ten Hagen, T. A. Fritz, and L. A. Tabak
All in the family: the UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferases
Glycobiology, January 1, 2003; 13(1): 1R - 16R.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
G. D. Leikauf, M. T. Borchers, D. R. Prows, and L. G. Simpson
Mucin Apoprotein Expression in COPD*
Chest, May 1, 2002; 121 (2009): 166S - 182S.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. G. T. Hagen, G. S. Bedi, D. Tetaert, P. D. Kingsley, F. K. Hagen, M. M. Balys, T. M. Beres, P. Degand, and L. A. Tabak
Cloning and Characterization of a Ninth Member of the UDP-GalNAc:Polypeptide N-Acetylgalactosaminyltransferase Family, ppGaNTase-T9
J. Biol. Chem., May 11, 2001; 276(20): 17395 - 17404.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Ju, R. D. Cummings, and W. M. Canfield
Purification, Characterization, and Subunit Structure of Rat Core 1 beta 1,3-Galactosyltransferase
J. Biol. Chem., January 4, 2002; 277(1): 169 - 177.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (22)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Kingsley, P. D.
Right arrow Articles by Tabak, L. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kingsley, P. D.
Right arrow Articles by Tabak, L. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?