Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (12)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Mattila, P.
Right arrow Articles by Renkonen, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mattila, P.
Right arrow Articles by Renkonen, R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Glycobiology, 2000, Vol. 10, No. 10 1041-1047
© 2000 Oxford University Press

Functional expression of Escherichia coli enzymes synthesizing GDP-L-fucose from inherent GDP-D-mannose in Saccharomyces cerevisiae

Pirkko Mattila1,2, Jarkko Räbinä2, Solveig Hortling2, Jari Helin3 and Risto Renkonen2,4

2Department of Bacteriology and Immunology, Haartman Institute, University of Helsinki, 3Institute of Biotechnology, University of Helsinki, and 4Helsinki University Central Hospital, Laboratory Diagnostics, Helsinki, Finland

Received on March 25, 2000; revised on May 5, 2000; accepted on May 20, 2000.


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Material and methods
 Acknowledgments
 Abbreviations
 References
 
Fucosylation of glycans on glycoproteins and -lipids requires the enzymatic activity of relevant fucosyltransferases and GDP-L-fucose as the donor. Due to the biological importance of fucosylated glycans, a readily accessible source of GDP-L-fucose would be required. Here we describe the construction of a stable recombinant S.cerevisiae strain expressing the E.coli genes gmd and wcaG encoding the two enzymes, GDP-mannose-4,6-dehydratase (GMD) and GDP-4-keto-6-deoxy-D-mannose-3,5-epimerase/4-reductase (GMER(FX)) respectively, needed to convert GDP-mannose to GDP-fucose via the de novo pathway. Taking advantage of the rich inherent cytosolic GDP-mannose pool in S.cerevisiae cells we could easily produce 0.2 mg/l of GDP-L-fucose with this recombinant yeast strain without addition of any external GDP-mannose. The GDP-L-fucose product could be used as the fucose donor for {alpha}1,3fucosyltransferase to synthesize sialyl Lewis x (sLex), a glycan crucial for the selectin-dependent leukocyte traffic.

Key words: glycans/GDP/E.coli/synthesis


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Material and methods
 Acknowledgments
 Abbreviations
 References
 
L-Fucose is a crucial monosaccharide present in several biologically important glycans (Feizi and Galustian, 1999Go; Palcic, 1999Go). In prokaryotes L-fucose is mainly present in polysaccharides of the cell wall, and in animals L-fucose is a part in glycoconjugates such as ABH-and Lewis antigens, either bound in the cell membrane or secreted into biological fluids (Lowe and Marth, 1999Go). Fucosylation requires a nucleotide sugar, GDP-L-fucose, as the donor of fucose, and the enzyme, fucosyltransferase, which catalyses the transfer of L-fucose into the glycan acting as an acceptor (Becker and Lowe, 1999Go).

In eukaryotic cells GDP-L-fucose can be synthesized via two different pathways, either by the more prominent de novo pathway or by the minor salvage pathway (Becker and Lowe, 1999Go). The de novo pathway starts from GDP-D-mannose; the first step is dehydration reaction catalyzed by specific nucleotide-sugar dehydratase, GDP-mannose-4,6-dehydratase (GMD). This leads to the formation of an unstable GDP-4-keto-6-deoxy-D-mannose, which undergoes a subsequent 3,5 epimerization and then a NADPH–dependent reduction with the consequent formation of GDP-L-fucose (Figure 1). These two last steps are catalyzed by a single, bifunctional enzyme GDP-4-keto-6-deoxy-D-mannose-3,5-epimerase/4-reductase (GMER, also known as FX in man). The salvage pathway instead includes two enzymatic reactions and takes advantage of fucose released from decomposed carbohydrates. Fucose is first phosphorylated by fucokinase to fucose-1-P, which then acts further as a substrate for GDP-L-fucose pyrophosphorylase resulting in formation of GDP-L-fucose (Becker and Lowe, 1999Go) (Figure 1).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 1. In eukaryotic cells GDP-L-fucose can be synthesized via two different pathways, either by (A) the more prominent de novo pathway or by (B) the minor salvage pathway.

 
The genes coding for GMD and GMER (FX) activities for the de novo pathway have been cloned from several bacteria, plants and mammals (Tonetti et al., 1996Go; Bonin et al., 1997Go; Sturla et al., 1997Go; Andrianopoulos et al., 1998Go; Ohyama et al., 1998Go; Rizzi et al., 1998Go; Sullivan et al., 1998Go; Bisso et al., 1999Go). In the wca- gene locus of E.coli, the genes responsible for GMD and GMER (FX)–activities are called gmd and wcaG, respectively (Sturla et al., 1997Go; Sullivan et al., 1998Go). The E.coli GMD is formed by 42kD subunits and appears most probably as a hexamer. This enzyme is known to be inhibited by GDP-L-fucose, the end product of the cascade (Sullivan et al., 1998Go). The E.coli wcaG codes for a bifunctional homodimeric enzyme GMER (FX) with a molecular weight of 70 kDa (Sullivan et al., 1998Go).

The yeast S.cerevisiae is an ideal host to express the de novo pathway enzymes for the synthesis of GDP-L-fucose (Hirschberg et al., 1998Go). In the yeast cells glycosylation is largely restricted to mannosylation and they are not known to have fucose metabolism of their own (Hashimoto et al., 1997Go; Romanos et al., 1992Go). Thus, the cytoplasm of yeast cells is a relatively rich source of GDP-D-mannose, the starting material for the de novo pathway. In the present study, we transformed E.coli genes coding for the de novo pathway enzymes dehydratase (gmd) and epimerase/reductase (wcaG) to S.cerevisiae and showed that these genes can be expressed in a functionally active form thus synthesizing GDP-L-fucose from the inherent, yeast-borne GDP-D-mannose.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Material and methods
 Acknowledgments
 Abbreviations
 References
 
Preparation of gmd and wcaG gene constructs and screening of S.cerevisiae transformants
In order to induce GDP-L-fucose synthesis in S. cerevisiae the E.coli gmd coding for GDP-D-mannose-4,6 dehydratase (GMD) activity and wcaG coding for GDP-4-keto-6-deoxy-D-mannose epimerase/reductase, i.e., GMER (FX), activity were inserted into pESC-leu-vector under GAL1 and GAL10 promoters, respectively (Figure 2). The gmd was inframe with c-myc-epitope and the wcaG with FLAG-epitope as revealed by DNA sequencing (data not shown).



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 2. The gmd and wcaG coding regions were amplified from E.coli K-12 wca gene cluster. The gmd-gene was subcloned under PGAL1-promoter inframe with c-myc-epitope and the wcaG-gene under PGAL10-promoter inframe with FLAG-epitope.

 
The vector controls without any genes, single constructs containing only either gmd or wcaG, or double constructs containing both genes were transformed into two yeast host strains YPH 499 and YPH 501. Several transformants of both host strains capable of surviving and proliferating on selective leucine deficient drop-out plates were screened for expression of gmd and wcaG genes on RNA level as well as the corresponding enzymes, GMD and (GMER) FX, on protein level.

Expression of gmd and wcaG in S.cerevisiae
In Northern blot analysis a 1.3 kb transcript was detected for gmd in both yeast strains, YPH 499 and YPH 501, transformed with either only E.coli gmd (data not shown) or both gmd and wcaG (Figure 3A). When the presence of the corresponding enzyme, GMD was assayed with the c-myc antibody in Western blots, a 48 kDa protein band was detected in the single transfectants containing only the gmd gene (data not shown) or double transfectants containing both the gmd and wcaG genes (Figure 4A). Concomitantly the mock transformants showed no signals in either Northern or Western blots.



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 3. Total RNA was extracted from double transformant yeast cells as well as from negative controls. The Northern blots were probed with PCR products amplified from E.coli K-12 wca gene cluster. (A) While the negative control, i.e., yeast cells with the vector only, showed no signal, a 1.3 kb transcript was detected for gmd in both yeast strains YPH 499 and YPH 501 transformed with gmd and wcaG genes. (B) Similarly a 1.1 kb band for wcaG was present in Northern blot analysis from both yeast strains YPH 499 and YPH 501 transformed with both gmd and wcaG.

 


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 4. The expression of GMD and GMER (FX) enzymes. (A) The presence of GMD enzyme was assayed with the c-myc antibody in Western blots. Although no protein was seen in the mock-transformants, a 48 kDa protein band was detected in the double transformants containing the gmd and wcaG genes. (B) The enzyme GMER (FX) coded by wcaG gene was expressed as a 40 kDa band as detected with anti-FLAG-antibody. Again, no relevant bands were detected in mock transfected controls.

 
Correspondingly a 1.1 kb band for wcaG was present in Northern blot analysis from both yeast strains YPH 499 and YPH 501 transformed with either only E.coli wcaG (data not shown) or both gmd and wcaG genes (Figure 3B). The corresponding enzyme coded by wcaG was expressed as a 40 kDa band as detected with anti-FLAG antibody (Figure 4B). Again, no relevant bands were detected in mock controls or with control antibodies.

Enzymatic activity of E.coli GMD and FX in yeast
The intermediate products of the de novo pathway from GDP-D-mannose to GDP-L-fucose (GDP-4-keto-6-deoxy-D-mannose and GDP-4-keto-6-deoxy-L-galactose) are known to be labile and not feasible to monitor in a high throughput screening approach. Thus, we used a microwell plate assay developed in our laboratory for measuring the {alpha}1,3fucosylation. In this assay biotinylated polyacrylamide conjugated sLN and recombinant {alpha}1,3fucosyltransferase VI were added to yeast cell lysates either not containing (mock- or only single transformants with either gmd or wcaG) or containing GDP-L-fucose, i.e., double transformants with both the gmd and wcaG genes. The readout of this assay was the turnover of sialyllactosamine to sLex detected by specific antibodies and time-resolved immunofluorometry. As the relevant acceptor and enzyme were always present in this assay, the only limiting factor in the generation of sLex from sLN was the presence or absence of GDP-L-fucose. This is shown in Figure 5a where the presence of exogenous GDP-L-fucose directly dictated the formation of sLex from sLN.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 5. Measuring the presence of GDP-L-fucose with a assay where conversion of sLN to sLex is detected with an anti sLex antibody and time resolved immunofluorometry. (A) The relevant acceptor (sLN) and enzyme ({alpha}1,3fucosyltransferase) were always present in this assay. Thus the only limiting factor in the generation of sLex from sLN was the presence or absence of GDP-L-fucose. (B) For strain 499 and (C) for strain 501, both the mock-transformants as well as the yeast cells transformed separately only with gmd or wcaG were unable to synthesize GDP-L-fucose. When the lysates of gmd and wcaG transformed yeast clones were mixed together, the synthesis of sLex was detected.

 
Both the mock-transfectants as well as the yeast cells transformed separately only with gmd or wcaG were unable to synthesize GDP-L-fucose resulting in background values in the enzymatic assay (Figure 5B and 5C). When the lysates of gmd and wcaG expressing yeast clones were mixed together, the synthesis of sLex was increased from 0% (background level) to 10.7% (YPH 499) or to 16.6% (YPH 501) in a 1 h assay (Figure 5B,C). To prove that these genes could be transformed into the same yeast cell host gmd was expressed under GAL1 promoter and wcaG under GAL10 promoter within the same pESC-leu vector in either YPH 499 or YPH 501. These double transfectants were able to produce GDP-L-fucose enough to enable 3.4% (YPH 499) and 5.1% (YPH 501) of the sLN acceptor to be converted to sLex in a 1 h assay (Figure 6).



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 6. The gmd or wcaG genes could be transformed into the same yeast cell. (A) For strain 499 and (B) for strain 501; these double transfectants were able to produce GDP-L-fucose. External GDP-D-mannose added to the yeast cell lysates before incubation with relevant sLN acceptor and recombinant {alpha}1,3fucosyltransferase increased the amount of GDP-L-fucose synthesis 3-fold.

 
To determine whether the amount of the inherent, yeast-produced GDP-mannose was a limiting factor for the GDP-L-fucose synthesis in the double transformed yeast strains, external GDP-D-mannose was added (0–500 µM) to the yeast cell lysates before incubation with relevant sLN acceptor and recombinant {alpha}1,3fucosyltransferase. Addition of external GDP-D-mannose increased the amount of GDP-L-fucose synthesis 3-fold (Figure 6), i.e., from 3.4% to 12.5% (YPH 499) or from 5.1% to 12.5% (YPH 501). We also show that the addition of exogenous NAPDH did not further enhance the synthesis of GDP-L-fucose suggesting that the concentration of this cofactor in the yeast cell lysates does not represent a limiting factor in this assay (data not shown).

Purification and MALDI-TOF MS of GDP-L-fucose
To further confirm the synthesis and to quantitate the amount of GDP-L-fucose produced in the gmd and wcaG expressing yeast cells, Aleuria aurantia lectin affinity chromatography was used to purify the product. As monitored with the enzymatic {alpha}1,3fucosyltransferase assay, most of the GDP-L-fucose bound to the lectin column and was eluted with addition of exogenous L-fucose. The peak fraction was further purified by size-exclusion HPLC, in which the retention times of both the purified product and commercial GDP-L-fucose was 16.2 min. As compared to external standard (GDP-L-fucose), the amount of GDP-L-fucose after purification was 3 µg per 1 ml of the original yeast cell lysate, corresponding to 0.2 mg/l of GDP-L-fucose in the original yeast cell culture.

This HPLC-purified product was then subjected to a MALDI-TOF MS analysis. The product purified from the double transfected yeast cells comigrating with the commercial GDP-L-fucose gave a single peak at m/z 588.04 (calculated m/z for [M-H] of GDP-L-fucose is 588.08). A single peak seen in the appropriate area in MALDI-TOF MS not only indicates that the product is GDP-L-fucose, but also shows that it was free of other nucleotide sugars (Figure 7).



View larger version (10K):
[in this window]
[in a new window]
 
Fig. 7. MALDI-TOF mass spectrometry of Aleuria aurantia lectin affinity and size-exclusion HPLC purified GDP-L-fucose produced in the transfected yeast cells. The purified product gave a single peak at m/z 588.04; calculated m/z for [M-H] of GDP-L-fucose is 588.08.

 

    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Material and methods
 Acknowledgments
 Abbreviations
 References
 
The biosynthesis of GDP-L-fucose, which acts as a nucleotide-sugar donor for fucosylation, has received increased interest after a number of {alpha}1,2-, {alpha}1,3-, and {alpha}1,6-fucosyltransferase genes have been cloned, sequenced, and expressed. Furthermore, the role of fucosylated glycans such as sLex and/or Lex, have been shown to be crucial in selectin dependent extravasation of leukocytes and tumor cells as well as in bacterial and parasitic infections (Vestweber and Blanks, 1999Go). Currently GDP-L-fucose is still a relatively expensive nucleotide sugar and thus laboratories working in the field of fucosylation would benefit of more accessible sources of it.

There are two major strategies for the synthesis of GDP-L-fucose, the chemical and the enzymatical pathways. Various approaches have been used in the relatively complex chemical synthesis starting from L-fucose the endproduct being GDP-L-fucose (Adelhorst and Whitesides, 1993Go; Murray et al., 1997Go). On the other hand, enzymatic synthesis of GDP-L-fucose can also be divided into two pathways, the predominant de novo route starting from GDP-D-mannose and the minor salvage pathway using L-fucose as the starting material (Becker and Lowe, 1999Go). The latter pathway has been successfully performed with purified enzymes in a recycling one-pot approach, but not yet with recombinant enzymes (Ichikawa et al., 1992Go, 1994). Furthermore this salvage pathway can be utilized with the help of enzymes from a nonpathogenic protozoa Crithidia fasciculata (Mengeling and Turco, 1999Go). This parasite expresses cytosolic D-arabinose-1-kinase and D-arabinose-1-P-pyrophosphorylase activities. Besides of synthesizing GDP-D-arabinose from D-arabinose these enzymes can also use L-fucose as a substrate leading to the synthesis of GDP-L-fucose even though under normal conditions C. fasciculata is not known to have fucose-containing molecules at all (Mengeling and Turco, 1999Go).

In prokaryotic cells GDP-L-fucose is synthesized only via the de novo pathway starting from GDP-D-mannose. The genes participating into this pathway have been identified in a broad range of organisms, including Gram-negative bacteria, such as E.coli, as well as Salmonella and Pseudonomas species (Tonetti et al., 1998Go). S.cerevisiae is the host of choice to generate GDP-L-fucose by the de novo pathway since it is rich in cytosolic GDP-D-mannose as it requires this donor for the extensive mannosylation of its glycoproteins. N-glycans in S.cerevisiae are composed of GlcNAc- and Man-residues, while the O-glycans contain only mannose (Romanos et al., 1992Go). Furthermore, the yeast itself lacks the relevant enzymes to generate GDP-L-fucose per se, thus making the monitoring of the functional expression of the transformed genes feasible (Romanos et al., 1992Go; Hashimoto et al., 1997Go).

Previous work has shown that gmd and wcaG can be overexpressed in E.coli and that when exogenous GDP-D-mannose is provided to the reaction, GDP-L-fucose is synthesized (Sturla et al., 1997Go; Sullivan et al., 1998Go). However, our work offers a major improvement into this approach as no exogenous expensive GDP-D-mannose needs to be added to the yeast cell lysates expressing GMD and GMER (FX) enzymes.

The availability of GDP-D-mannose was shown to be a limiting factor for our yeast transformant expressing gmd as well as wcaG genes. In yeast cells GDP-D-mannose is synthesized in the cytoplasm and further transported to the lumenal space of Golgi apparatus by specific antiporter system that involves exchange with guanosine 5'-monophosphate (GMP). Thus, as the recombinant enzymes are expressed in the cytosolic compartment of the yeast, it might be beneficial to use mutant yeast cells, which have been characterized to have a defect in the GMP antiporter function leading to increased cytosolic GDP-D-mannose levels.

A very rare human disease with hallmarks of leukocytosis, increased incidence of infections, and mental retardation has been described previously (Etzioni et al., 1998Go; Becker and Lowe, 1999Go). Screening of the leukocytes of these LAD II patients revealed lack of all fucosylated glycoproteins and -lipids, thus suggesting for a common defect in the GDP-L-fucose synthesis and/or its availability in the Golgi (Karsan et al., 1998Go). There are most probably at least two types of modifications in the LAD II patients. The first cases were shown to have impaired function of GMD activity (Sturla et al., 1998Go). However, a third patient representing clinical features similar or identical to the two first LAD II patients has recently been identified (Korner et al., 1999Go; Marquardt et al., 1999aGo). The defect in this individual is not in the synthesis of GDP-L-fucose, but rather in the transportation of GDP-L-fucose to Golgi (Korner et al., 1999Go; Lubke et al., 1999Go). However, the patient has been successfully treated with dietary fucose, which is metabolized via the salvage pathway to GDP-L-fucose and finally transported to Golgi via a putatively impaired, yet partially functional GDP-fucose transporter system (Marquardt et al., 1999bGo). This impaired route offers a possibility to further analyze the regulation of GDP-L-fucose synthesis and transportation into the Golgi (Puglielli and Hirschberg, 1999Go).

Taken together, we have shown here that bacterial gmd and wcaG genes can be expressed as functional enzymes in S.cerevisiae and due to the inherent GDP-D-mannose synthesis in yeast cells they synthesize GDP-L-fucose. This approach was shown to be relatively effective, as >0.2 mg/l GDP-L-fucose was produced by specifically transfected yeast cells. It should also be noted that no optimization of the yeast cell culture systems has been performed so far to increase the yield. The GDP-L-fucose generated by this rapid route can be further converted to bioactive fucosylated glycans with relevant recombinant fucosyltransferases.


    Material and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Material and methods
 Acknowledgments
 Abbreviations
 References
 
Preparation of gene constructs
The gmd and wcaG coding regions were amplified from E.coli K-12 wca gene cluster (accession U38473). Advantage polymerase (Clontech, Palo Alto, CA) was used with the primer set 5'AAGAACTCGAGTCAAAAGTCGCTCTCAT3' (creating a XhoI-site) and 5'TTATAAGCTTTTATGACTCCAGCGCGA3' (creating a HindIII-site) to amplify gmd (nucleotides 8662–9780) as well as primer set 5'CAAGAAAGATCTCAAGTAAACAACGAGTTTTT3' (creating a BglII site) and 5'TTATGAGCTCTTACCCCCGAAAGCGGTC3' (creating a SacI site) to amplify wcaG (nucleotides 9786–10748). Both PCR products were cloned into PCR-blunt II TOPO (Zero-blunt-TOPO; PCR-cloning kit, Invitrogen, Groningen, The Netherlands). Both inserts were digested out of PCR-blunt II TOPO and transferred to pESC-leu vector (Stratagene, La Jolla, CA). The gmd gene was subcloned under PGAL1-promoter inframe with c-myc-epitope and the wcaG gene under PGAL10-promoter inframe with FLAG-epitope. Also vectors containing only either of the inserts were prepared. The constructs were confirmed by sequencing (ABI 310, PE Biosystems, Foster City, CA).

Transformation into S.cerevisiae
The pESC-leu vectors not containing any genes, containing either gmd or wcaG or both of the genes were transformed into YPH 499 and YPH 501 yeast host strains by lithium acetate method following the instructions of the manufacturer (Stratagene). Transformants were selected using leucine dropout plates.

Selection of yeast transformants
Several transformants growing on leucine dropout plates were picked up and grown in 25 ml of dextrose containing selective synthetic dropout (SD) media overnight. The GAL1 and GAL10 promoters were repressed when transformed yeast cells were grown in dextrose containing SD media and induced when the cells are changed to grow in galactose containing SG media. In a typical experiment the yeast cell mass was increased by growing them in SD media overnight and the expression of transformed genes was induced for another 24 h by chancing the carbon source of the media from dextrose to galactose. After centrifugation the yeast cells were grown another 24 h in the same volume in synthetic galactose containing dropout (SG) media and the OD600 was measured; 1x109 cells were spun down and suspended in 0.5 ml of breaking buffer containing 1% TX-100 and 10% glycerol, and the cells were lysed mechanically by vortexing with glass beads (1/3 volume). After centrifugation the cell lysates were subjected to protein analysis as well as to enzymatic activity assays; 25 µg of total protein was used in Western blots and 0.3–0.4 µg/µl in the activity assays.

Expression of E.coli gmd and wcaG in yeast
Expression of recombinant proteins was detected on RNA and protein levels. Total RNA (15 µg) was extracted from double transformant yeast cells as well as from negative controls and broken mechanically with glass beads and subjected to Northern blot analysis as described previously (Mattila et al., 1996Go). The blots were probed with PCR products amplified from E.coli K-12 wca gene cluster. The expression of GMD and GMER (FX) was studied in Western blot using the antibodies against c-myc and FLAG-epitopes, respectively. Chemiluminescence (ECL, Amersham) was used as a detection method according to manufacturer’s instructions.

Determination of GDP-L-fucose synthesis
The presence of GDP-L-fucose was assayed by using yeast cell lysate as a source of GDP-L-fucose in a fucosyltransferase reaction converting sialyl-N-acetyllactosamine (sLN) to sLex. The reaction mixture included fucosyltransferase VI (FucTVI 25 µU, Calbiochem; San Diego, CA), yeast cell lysate diluted 1:20 as a fucose donor, sLN-polyacrylamide-biotin conjugate (Syntesome; Moscow, Russia) as a fucose acceptor, 50 mM MOPS-NaOH (pH 7.5), 6 mM MnCl2, 0.5% Triton X-100, 0.1% BSA, and 1 mM ATP. After 1 h incubation in +37°C, 50 µl aliquots of the reaction mixtures were transferred to microtitration strips coated with streptavidin (Wallac; Turku, Finland) to immobilize the biotinylated glycoconjugate. The fucosylated reaction product sLex was then detected and quantified by time-resolved fluorometry (Wallac) using anti-sLex primary antibody KM-93 (Calbiochem) and europium-labeled (DELFIA Eu-labeling kit: Wallac) anti-mouse IgM secondary antibody (Sanbio; Uden, The Netherlands) as described in this laboratory before (Rabina et al., 1997Go).

Purification of GDP-L-fucose
For large scale GDP-L-fucose synthesis one transformant containing both gmd and wcaG genes was grown 24 h in 750 ml of selective SD media and another 24 h in selective SG media. The cells were collected when OD600 was 3.7, and the pellet was suspended in concentration of 2 x 109 cells/ml (total volume 45 ml) of breaking buffer containing 1% TX-100 and 10% glycerol and lysed with glass beads. After vigorous 30 min vortexing the glass beads and cell debris were centrifuged and the clear lysate was filtrated through YM-10 Centricon column (Millipore Corporation, Bedford, MA) o/n +4°C according to manufacturer’s instructions.

GDP-L-fucose synthesized in yeast cells was then purified by two chromatographic steps. Lectin affinity chromatography was performed on a small column (diameter 0.5 cm) of agarose-bound Aleuria aurantia lectin (2 ml; Vector Laboratories, Burlingame, CA). The column was equilibrated with 10 mM HEPES buffer, pH 7.5, containing 0.15 M NaCl and 0.02% NaN3. After application of yeast cell lysate (4 ml) into the column, the elution was performed with 4 ml of the equilibration buffer followed by 4 ml of the buffer containing 25 mM L-fucose. Fractions of 1 ml were collected and assayed for the presence of GDP-L-fucose.

For desalting GDP-L-fucose and removal of the haptenic sugar, size-exclusion HPLC on a Superdex Peptide HR 10/30 column (Pharmacia, Sweden) was used. The elution was performed at 1 ml/min using 50 mM NH4HCO3 and the effluent was monitored with a UV detector at 254 nm. The amount of GDP-L-fucose was calculated from peak areas by reference to external standard (GDP-L-fucose, Calbiochem).

Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry
Maldi-TOF mass spectrometry was performed with a Biflex mass spectrometer (Bruker Daltonics, Germany). Analysis was performed in the negative-ion linear delayed-extraction mode, using 2,4,6–trihydroxyacetophenone (THAP, Fluka Chemica) as the matrix as described (Nyman et al., 1998Go). External calibration was performed with THAP matrix dimer and sialyl Lewis x ß-methylglycoside (Toronto Research Chemicals, Canada).


    Acknowledgments
 Top
 Abstract
 Introduction
 Results
 Discussion
 Material and methods
 Acknowledgments
 Abbreviations
 References
 
This work was supported by grants from the Academy of Finland (101–36157), the Technology Development Center of Finland (40016/99), the Emil Aaltonen Foundation, the Helsinki University Central Hospital Research Funds, and the 350-year Anniversary Foundation of University of Helsinki.


    Abbreviations
 Top
 Abstract
 Introduction
 Results
 Discussion
 Material and methods
 Acknowledgments
 Abbreviations
 References
 
G and Gal, D-galactose; GN and GlcNAc, N-acetyl-D-glucosamine; MALDI-TOF MS, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry; sLN, sialyllactosamine; sLex, sialyl-Lewis x, GMD, GDP-mannose-4,6-dehydratase; FX and GMER; GDP-4-keto-6-deoxy-D-mannose-3,5-epimerase/4-reductase.


    Footnotes
 
1 To whom correspondence should be addressed at: Department of Bacteriology and Immunology, P.O. Box 21 (Haartmaninkatu 3), FIN-00014 University of Helsinki, Finland Back


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Material and methods
 Acknowledgments
 Abbreviations
 References
 
Adelhorst,K. and Whitesides,G.M. (1993) Large-scale synthesis of ß-L-fucopyranosyl phosphate and the preparation of GDP-ß-L-fucose. Carbohydrate Res., 242, 69–76.[ISI][Medline]

Andrianopoulos,K., Wang,L. and Reeves,P.R. (1998) Identification of the fucose synthetase gene in the colanic acid gene cluster of Escherichia coli K-12. J. Bacteriol., 180, 998–1001.[Abstract/Free Full Text]

Becker,D.J. and Lowe,J.B. (1999) Leukocyte adhesion deficiency type II [Review]. Biochim. Biophys. Acta–Mol. Basis Disease, 1455, 193–204.[Medline]

Bisso,A., Sturla,L., Zanardi,D., De Flora,A. and Tonetti,M. (1999) Structural and enzymatic characterization of human recombinant GDP-D-mannose-4,6-dehydratase. FEBS Lett., 456, 370–374.[ISI][Medline]

Bonin,C.P., Potter,I., Vanzin,G.F. and Reiter,W.D. (1997) The MUR1 gene of Arabidopsis thaliana encodes an isoform of GDP-D-mannose-4,6-dehydratase, catalyzing the first step in the de novo synthesis of GDP-L-fucose. Proc. Natl. Acad. Sci. USA, 94, 2085–2090.[Abstract/Free Full Text]

Etzioni,A., Gershoni-Baruch,R., Pollack,S. and Shehadeh,N. (1998) Leukocyte adhesion deficiency type II: long-term follow-up. J. Allergy Clin. Immunol., 102, 323–324.[ISI][Medline]

Feizi,T. and Galustian,C. (1999) Novel oligosaccharide ligands and ligand-processing pathways for the selectins. Trends Biol. Sci., 24, 369–372.

Hashimoto,H., Sakakibara,A., Yamasaki,M. and Yoda,K. (1997) Saccharomyces cerevisiae VIG9 encodes GDP-mannose pyrophosphorylase, which is essential for protein glycosylation. J. Biol. Chem., 272, 16308–16314.[Abstract/Free Full Text]

Hirschberg,C.B., Robbins,P.W. and Abeijon,C. (1998) Transporters of nucleotide sugars, ATP and nucleotide sulfate in the endoplasmic reticulum and Golgi apparatus. Annu. Rev. Biochem., 67, 49–69.[ISI][Medline]

Ichikawa,Y., Lin,Y.-C., Dumas,D.P., Garcia-Junceda,S., Garcia-Junceda,E., Williams,M.A., Bayer,R., Ketcham,C., Walker,L.E., Paulson,J.C. and Wong,C.-H. (1992) Chemical-enzymatic synthesis and conformational analysis of sialyl Lewis x and derivatives. J. Am. Chem. Soc., 114, 9283–9298.

Ichikawa,Y., Wang,R. and Wong,C.H. (1994) Regeneration of sugar nucleotide for enzymatic oligosaccharide synthesis. Methods Enzymol., 247, 107–127.[ISI][Medline]

Karsan,A., Cornejo,C.J., Winn,R.K., Schwartz,B.R., Way,W., Lannir,N., Gershoni-Baruch,R., Etzioni,A., Ochs,H.D. and Harlan,J.M. (1998) Leukocyte Adhesion Deficiency Type II is a generalized defect of de novo GDP-fucose biosynthesis. Endothelial cell fucosylation is not required for neutrophil rolling on human nonlymphoid endothelium. J. Clin. Invest., 101, 2438–2445.[ISI][Medline]

Korner,C., Linnebank,M., Koch,H.G., Harms,E., von Figura,K. and Marquardt,T. (1999) Decreased availability of GDP-L-fucose in a patient with LAD II with normal GDP-D-mannose dehydratase and FX protein activities. J. Leuk. Biol., 66, 95–98.

Lowe,J. and Marth,J. (1999) Structures common to different types of glycans. In Varki,A., Cummings,R., Esko,J., Freeze,H., Hart,G., and Marth,J. (eds.), Essentials of Glycobiology. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 211–252.

Lubke,T., Marquardt,T., von Figura,K. and Korner,C. (1999) A new type of carbohydrate-deficient glycoprotein syndrome due to a decreased import of GDP-fucose into the golgi. J. Biol. Chem., 274, 25986–25989.[Abstract/Free Full Text]

Marquardt,T., Brune,T., Luhn,K., Zimmer,K.P., Korner,C., Fabritz,L., van der Werft,N., Vormoor,J., Freeze,H.H., Louwen,F. and others. (1999a) Leukocyte adhesion deficiency II syndrome, a generalized defect in fucose metabolism. J. Pediatr., 134, 681–688.[ISI][Medline]

Marquardt,T., Luhn,K., Srikrishna,G., Freeze,H.H., Harms,E. and Vestweber,D. (1999b) Correction of leukocyte adhesion deficiency type II with oral fucose. Blood, 94, 3976–3985.[Abstract/Free Full Text]

Mattila,P., Joutsjoki,V., Kaitera,E., Majuri,M.L., Niittymaki,J., Saris,N., Maaheimo,H., Renkonen,O., Renkonen,R. and Makarow,M. (1996) Targeting of active rat alpha 2,3-sialyltransferase to the yeast cell wall by the aid of the hsp 150 delta-carrier: toward synthesis of sLe (x)-decorated L-selectin ligands. Glycobiology, 6, 851–859.[Abstract/Free Full Text]

Mengeling,B.J. and Turco,S.J. (1999) A high-yield, enzymatic synthesis of GDP-D-[3H]arabinose and GDP-L-[3H]fucose. Anal. Biochem., 267, 227–233.[ISI][Medline]

Murray,B.W., Wittmann,V., Burkart,M.D., Hung,S.C. and Wong,C.H. (1997) Mechanism of human {alpha}-1,3-fucosyltransferase V: glycosidic cleavage occurs prior to nucleophilic attack. Biochemistry, 36, 823–831.[Medline]

Nyman,T.A., Kalkkinen,N., Tolo,H. and Helin,J. (1998) Structural characterisation of N-linked and O-linked oligosaccharides derived from interferon-alpha2b and interferon-alpha14c produced by Sendai-virus-induced human peripheral blood leukocytes. Eur. J. Biochem., 253, 485–493.[ISI][Medline]

Ohyama,C., Smith,P.L., Angata,K., Fukuda,M.N., Lowe,J.B. and Fukuda,M. (1998) Molecular cloning and expression of GDP-D-mannose-4,6-dehydratase, a key enzyme for fucose metabolism defective in Lec13 cells. J. Biol. Chem., 273, 14582–14587.[Abstract/Free Full Text]

Palcic,M.M. (1999) Biocatalytic synthesis of oligosaccharides [Review]. Curr. Opinion Biotechnol., 10, 616–624.[ISI][Medline]

Puglielli,L. and Hirschberg,C.B. (1999) Reconstitution, identification and purification of the rat liver golgi membrane GDP-fucose trasnporter. J. Biol. Chem., 274, 35596–35600.[Abstract/Free Full Text]

Rabina,J., Smithers,N., Britten,C.J. and Renkonen,R. (1997) A time-resolved immunofluorometric method for the measurement of sialyl Lewis x-synthesizing {alpha}1,3-fucosyltransferase activity. Anal. Biochem., 246, 71–78.[ISI][Medline]

Rizzi,M., Tonetti,M., Vigevani,P., Sturla,L., Bisso,A., Flora,A.D., Bordo,D. and Bolognesi,M. (1998) GDP-4-keto-6-deoxy-D-mannose epimerase/reductase from Escherichia coli, a key enzyme in the biosynthesis of GDP-L-fucose, displays the structural characteristics of the RED protein homology superfamily. Structure, 6, 1453–1465.

Romanos,M.A., Scorer,C.A. and Clare,J.J. (1992) Foreign gene expression in yeast: a review. Yeast, 8, 423–488.[ISI][Medline]

Sturla,L., Bisso,A., Zanardi,D., Benatti,U., De Flora,A. and Tonetti,M. (1997) Expression, purification and characterization of GDP-D-mannose 4,6-dehydratase from Escherichia coli. FEBS Lett., 412, 126–130.[ISI][Medline]

Sturla,L., Etzioni,A., Bisso,A., Zanardi,D., De Flora,G., Silengo,L., De Flora,A. and Tonetti,M. (1998) Defective intracellular activity of GDP-D-mannose-4,6-dehydratase in leukocyte adhesion deficiency type II syndrome. FEBS Lett., 429, 274–278.[ISI][Medline]

Sullivan,F.X., Kumar,R., Kriz,R., Stahl,M., Xu,G.Y., Rouse,J., Chang,X.J., Boodhoo,A., Potvin,B. and Cumming,D.A. (1998) Molecular cloning of human GDP-mannose 4,6-dehydratase and reconstitution of GDP-fucose biosynthesis in vitro. J. Biol. Chem., 273, 8193–8202.[Abstract/Free Full Text]

Tonetti,M., Sturla,L., Bisso,A., Benatti,U. and De Flora,A. (1996) Synthesis of GDP-L-fucose by the human FX protein. J. Biol. Chem., 271, 27274–27279.[Abstract/Free Full Text]

Tonetti,M., Sturla,L., Bisso,A., Zanardi,D., Benatti,U. and De Flora,A. (1998) The metabolism of 6-deoxyhexoses in bacterial and animal cells. Biochimie, 80, 923–931.[Medline]

Vestweber,D. and Blanks,J.E. (1999) Mechanisms that regulate the function of the selectins and their ligands. Physiol. Rev., 79, 181–213.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Plant Physiol.Home page
G. Watt, C. Leoff, A. D. Harper, and M. Bar-Peled
A Bifunctional 3,5-Epimerase/4-Keto Reductase for Nucleotide-Rhamnose Synthesis in Arabidopsis
Plant Physiology, April 1, 2004; 134(4): 1337 - 1346.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
K.-i. Nakayama, Y. Maeda, and Y. Jigami
Interaction of GDP-4-keto-6-deoxymannose-3,5-epimerase-4-reductase with GDP-mannose-4,6-dehydratase stabilizes the enzyme activity for formation of GDP-fucose from GDP-mannose
Glycobiology, October 1, 2003; 13(10): 673 - 680.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
M. Maki, N. Jarvinen, J. Rabina, H. Maaheimo, P. Mattila, and R. Renkonen
Cloning and functional expression of a novel GDP-6-deoxy-D-talose synthetase from Actinobacillus actinomycetemcomitans
Glycobiology, April 1, 2003; 13(4): 295 - 303.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (12)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Mattila, P.
Right arrow Articles by Renkonen, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mattila, P.
Right arrow Articles by Renkonen, R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?