Glycobiology, 2000, Vol. 10, No. 1 11-20
© 2000 Oxford University Press
Conversion of cellular sialic acid expression from N-acetyl- to N-glycolylneuraminic acid using a synthetic precursor, N-glycolylmannosamine pentaacetate: inhibition of myelin-associated glycoprotein binding to neural cells
Departments of Pharmacology and 4Neuroscience, The Johns Hopkins University School of Medicine, Baltimore, MD 21205, USA
Received on February 2, 1999; revised on July 7, 1999; accepted on July 7, 1999.
| Abstract |
|---|
|
|
|---|
Sialic acids are prominent termini of mammalian glycoconjugates and are key binding determinants for cellcell recognition lectins. Binding of the sialic aciddependent lectin, myelin-associated glycoprotein (MAG), to nerve cells is implicated in the inhibition of nerve regeneration after injury. Therefore, blocking MAG binding to nerve cell sialoglycoconjugates might enhance nerve regeneration. Previously, we reported that certain sialoglycoconjugates bearing N-acetylneuraminic acid (NeuAc) but not N-glycolylneuraminic acid (NeuGc) support MAG binding (Collins et al., 1997a). We now report highly efficient conversion of sialic acids on living neural cells from exclusively NeuAc to predominantly NeuGc using a novel synthetic metabolic precursor, N-glycolylmannosamine pentaacetate (ManNGcPA). When NG10815 neuroblastoma-glioma hybrid cells, which normally express only NeuAc (and bind to MAG), were cultured in the presence of 1 mM ManNGcPA, they expressed 8090% of their sialic acid precursor pool as NeuGc within 24 h. Within 5 days, 80% of their ganglioside-associated sialic acids and 70% of their glycoprotein-associated sialic acids were converted to NeuGc. Consistent with this result, treatment of NG10815 cells with ManNGcPA resulted in nearly complete abrogation of MAG binding. These results demonstrate that ManNGcPA treatment efficiently alters the sialic acid structures on living cells, with a commensurate change in recognition by a physiologically important lectin.
Key words: sialic acid biosynthesis/N-acetylmannosamine/N-acetylneuraminic acid/N-glycolylneuraminic acid/siglec recognition
| Introduction |
|---|
|
|
|---|
Sialic acids are abundant nonreducing terminal sugars on mammalian glycoconjugates. They differ from other mammalian monosaccharides in their complexity, bearing a carboxylic acid group, an N-acyl substituent, and an exocyclic glycerol side chain (Schauer, 1982
N-Acetylneuraminic acid (NeuAc), the predominant sialic acid in nature, is synthesized in vivo by a multistep pathway (Roseman, 1970
) beginning with the conversion of N-acetylglucosamine to N-acetylmannosamine-6-phosphate by a bifunctional epimerase/kinase (Kundig et al., 1966
; Hinderlich et al., 1997
). ManNAc-6-P is converted to NeuAc-9-P by condensation with phosphoenol pyruvate, and then to CMP-NeuAc which is the activated NeuAc donor for glycolipid and glycoprotein oligosaccharide biosynthesis (Kean and Roseman, 1966
; Watson et al., 1966
). Hydroxylation of NeuAc (in the CMP-NeuAc form) by a specific hyroxylase converts NeuAc to N-glycolylneuraminic acid (NeuGc), a member of the sialic acid family which is rare (or absent) in humans, but is common in non-neural tissues of many other species (Kawano et al., 1995
; Chou et al., 1998
).
To experimentally introduce modified sialic acids on intact cells and tissues, this pathway has been short-circuited by addition of unnatural N-acylmannosamines, including N-propanoyl-, N-butanoyl-, N-pentanoyl-, and N-levulinoylmannosamine, among others (Angelino et al., 1995
; Keppler et al., 1995
; Yarema et al., 1998
). These precursors are taken up, converted to the corresponding sialic acids, and expressed on cell surface glycoconjugates. Cells engineered to display modified sialic acids demonstrate altered pathogen binding, antigenicity, and chemical reactivity (Keppler et al., 1995
; Herrmann et al., 1997
; Mahal et al., 1997
; Schmidt et al., 1998
; Yarema et al., 1998
).
We and others have recently reported the carbohydrate binding specificity of a sialic acid binding lectin, myelin-associated glycoprotein (MAG), a member of the "siglec" family of immunoglobulin-like lectins (Kelm et al., 1994a
; Collins et al., 1997a
,b; Crocker et al., 1998
; Kelm et al., 1998
). In the nervous system, MAG functions in the stabilization of the myelin sheath surrounding axons (Fruttiger et al., 1995
; Bartsch et al., 1997
; Lassmann et al., 1997
; Sheikh et al., 1999
), and in the control of axon cytoarchitecture (Yin et al., 1998
). In addition, MAG inhibits nerve regeneration, and has been proposed to contribute to the limited functional recovery typical of central nervous system (e.g., spinal cord) injury (McKerracher et al., 1994
; Mukhopadhyay et al., 1994
; Schnaar et al., 1998
). Presumably, MAG binds to sialoglycoconjugate targets on nerve cells to initiate its physiological and pathological effects. MAG is highly restrictive in its requirements for sialic acid substructure, in that it requires the N-acetyl group, the glycerol side chain, and the carboxylic acid group for recognition (Collins et al., 1997a
,b; Kelm et al., 1998
). Given the sensitivity of MAG binding to even minor changes in sialic acid substructure, the goal of the experiments described here was to develop a highly efficient N-acylmannosamine precursor which would result in modification of a large proportion of the nerve cell sialic acid, rendering the cells resistant to MAG binding.
| Results |
|---|
|
|
|---|
NeuGc biosynthesis from ManNGc monoacetate
The goal of these studies was to convert sialic acids on live neuronal cells from NeuAc, which is a key determinant for MAG binding, to NeuGc, which is nonpermissive for MAG binding (Collins et al., 1997a
70%) was in the NeuGc form. The differential effect on pool size was cell type or species specific, in that treatment of a human T-cell-related cell line (Jurkat) with 20 mM ManNGcMA resulted in an increase in total sialic acid precursor pool size (comparable to treatment with ManNPr) which was nearly all NeuGc (data not shown).
|
|
Although ManNPr and ManNGcMA had very different effects on the sialic acid precursor pool size in NG10815 cells, the size of the ganglioside pool remained relatively constant (Figure 2, center panel). Treatment with 20 mM ManNPr converted
70% of the ganglioside sialic acid to the NeuPr form within 48 h, whereas treatment with 20 mM ManNGcMA resulted in less (
30%) conversion to the NeuGc form.
The glycoprotein sialic acid concentration was more sensitive to the precursor pool size, with total glycoprotein sialic acid increasing
2-fold in cells treated with ManNAc, increasing
1.4-fold in cells treated with ManNPr, and decreasing by
40% in cells treated with ManNGcMA (Figure 2, bottom panel). As with the gangliosides, treatment with 20 mM ManNPr converted
70% of the glycoprotein sialic acid to the NeuPr form within 48 h, whereas treatment with 20 mM ManNGcMA resulted in
30% conversion of glycoprotein sialic acids to the NeuGc form.
Although ManNPr was efficiently incorporated into gangliosides and glycoproteins as NeuPr, it was not used to modify MAG binding, since NeuPr is reported to support MAG (Kelm et al., 1998
), whereas NeuGc does not support MAG binding (Collins et al., 1997a
; Kelm et al., 1998
). Therefore, improved methods to deliver ManNGc into cells were tested.
NeuGc biosynthesis from ManNGc pentaacetate
Peracetylation has been shown to greatly increase uptake and anabolic utilization of carbohydrates (Sarkar et al., 1995
, 1997). Therefore, ManNGcMA was peracetylated to give N-glycolylmannosamine pentaacetate (ManNGcPA, Figure 1, R1 = Ac) and tested as a precursor for NeuGc biosynthesis. NG10815 cells were incubated with 0.1 or 1.0 mM ManNGcPA (or 5 mM ManNGcMA for comparison) for 48 h. Peracetylated sugars were routinely dissolved in dimethylsulfoxide (DMSO), and delivered to the cells in medium containing a final concentration of 0.5% DMSO, which was non-toxic to cells (see below). Whereas none of these treatments significantly altered the sialic acid precursor pool size, treatment with 1 mM ManNGcPA resulted in 82% conversion from NeuAc to NeuGc (Figure 3, top panel). Treatment with 0.1 mM ManNGcPA resulted in
2-fold greater conversion to the NeuGc form than did treatment with 5 mM ManNGcMA, indicating an increase in potency of 100-fold due to peracetylation. Incorporation of NeuGc into gangliosides and glycoproteins was related to the precursor pool composition, resulting in
50% NeuGc within 48 h when cells were treated with 1 mM ManNGcPA (Figure 3, center and bottom panels) and much less when cells were treated with 5 mM ManNGcMA. Total ganglioside and glycoprotein sialic acid levels were not significantly altered by treatment with the peracetylated precursor.
|
If incorporation of NeuGc into gangliosides and glycoproteins occurs during glycoconjugate turnover or via desialylation/resialylation, higher levels of conversion (above 50%) might require longer incubation times. To test this, NG10815 cells were treated with 1 mM ManNGcPA for up to 144 h. The sialic acid precursor pool was >80% in the NeuGc form within 24 h, and remained high throughout the experiment (Figure 4, top panel). Consistent with prior experiments, half of the ganglioside and glycoprotein sialic acids were converted to the NeuGc form within 48 h. Longer incubation resulted in increased incorporation of NeuGc, with gangliosides expressing
80% of their sialic acid as NeuGc and glycoproteins expressing 6070% as NeuGc as the experiment progressed (Figure 4, center and bottom panels).
|
To ensure that the per-O-acetylated derivative ManNGcPA did not result in significant production of O-acetylated forms of NeuGc, an aliquot of the extracted polar phase containing free sialic acids (see Materials and methods) from cells treated for 48 h with 1 mM ManNGcPA was subjected to thin layer chromatography in propanol:water (7:3) to resolve O-acetylated from non-O-acetylated sialic acids (Schauer, 1987
|
Effects of ManNGcPA-treatment on cell viability and growth
Treatment of NG10815 cells with 1 mM ManNGcPA sharply slowed growth and led to a modest decrease in cell viability after 70 h (from 91% (control) to 76% (1 mM ManNGcPA), see Figure 6). To address the possible basis for the toxic effects of the precursor, growth and cell viability were compared in cultures treated with glucose pentaacetate as a control. The glucose pentaacetate-treated cells demonstrated more profound decreases in cell growth and viability than the ManNGcPA-treated cells, indicating that uptake and deacetylation of peracetylated precursors, even glucose, is toxic to these cells at 1 mM concentrations. In contrast, treatment with 0.25 mM ManNGcPA resulted in no significant decrease in either cell growth or viability. Subsequent kinetic studies revealed that 0.25 mM ManNGcPA treatment resulted in >70% conversion of NeuAc to NeuGc in NG10815 cell gangliosides after 48 h, and a similar conversion in glycoproteins after 96 h (Figure 7). Withdrawal of the precursor results in partial reversal of the conversion after 24 h of chase. Growth of the cells in as low as 0.02 mM ManNGcPA for 48 h resulted in nearly 50% conversion of ganglioside sialic acids to the NeuGc form (data not shown).
|
|
Effect of ManNGcPA-treatment on myelin-associated glycoprotein binding
NG10815 cells, a mouse neuroblastoma/rat glioma hybrid, display many qualities of cholinergic neurons, including neurite outgrowth, synthesis, storage and release of acetylcholine, and functional synapse formation with muscle cells in vitro (Hamprecht, 1977
70% inhibition of MAG-Fc binding, whereas treatment with 1 mM ManNAc-tetraacetate had no significant effect on binding (Figure 9).
|
|
| Discussion |
|---|
|
|
|---|
As the major nonreducing terminal saccharide on mammalian glycoconjugates, sialic acids are key determinants for binding many lectins, toxins, and pathogens (Varki, 1997
The high selectivity of MAG for NeuAc rather than NeuGc offers an opportunity to subtly modify nerve cell sialic acids and thereby block MAG binding. Since MAG is implicated in maintaining stable myelinaxon interactions (Fruttiger et al., 1995
; Bartsch et al., 1997
; Lassmann et al., 1997
; Sheikh et al., 1999
), directing axon cytoarchitecture (Yin et al., 1998
), and controlling nerve regeneration after injury (McKerracher et al., 1994
; Mukhopadhyay et al., 1994
; Schäfer et al., 1996
; Schnaar et al., 1998
), such modification has implications both for studying and possibly modulating important neural cellcell interactions.
Modification of sialic acids in live cells or animals using synthetic N-acylmannosamines was pioneered by the Reutter laboratory (Kayser et al., 1992a
). The incorporation of synthetic N-acylmannosamines into sialic acids, and their effects on cell growth, morphology, antigen expression, viral susceptibility, and tumor growth have been reported (Kayser et al., 1992a
; Angelino et al., 1995
; Keppler et al., 1995
; Weiser et al., 1996
; Herrmann et al., 1997
; Hinderlich et al., 1997
; Schmidt et al., 1998
). More recently, synthetic N-levulinoylmannosamine was used to introduce novel chemical reactivity onto cell surfaces (Mahal et al., 1997
; Yarema et al., 1998
).
In the current study, we applied sialic acid mass analysis to determine, for the first time, absolute levels of incorporation of synthetic and natural N-acylmannosamines into the sialic acid precursor pool, glycolipids (gangliosides) and glycoproteins in the same cell population. The observation that the sialic acid precursor pool size is highly elastic is consistent with a prior report on the effect of ManNAc treatment on sialic acid synthesis (Thomas et al., 1985
). Although our analytical conditions did not routinely distinguish between the free and nucleotide sugar forms of sialic acid, it has been reported that the precursor pool is predominantly free sialic acid (Thomas et al., 1985
), a contention supported by thin layer chromatography analysis in this study (Figure 5). Large changes in the precursor pool size did not quantitatively impact sialic acid incorporation into gangliosides, and only modestly affected incorporation into glycoproteins. However, conversion of the precursor pool from exclusively NeuAc to largely NeuPr or NeuGc resulted in incorporation of the modified sialic acids into both gangliosides and sialoglycoproteins. The delay of incorporation of modified sialic acids into glycoconjugates compared to their appearance in the precursor pool (e.g., Figure 4) may reflect the rate of turnover of gangliosides and sialoglycoproteins in these cells.
Our finding of equivalent incorporation of precursor NeuPr or NeuGc into both gangliosides and sialoglycoproteins in living cells suggests that various sialyltransferases readily use the modified sialic acid precursors. These results are consistent with previous reports demonstrating insensitivity of sialyltransferases to chemically modified CMP-sialic acid derivatives in vitro (Higa and Paulson, 1985
; Kelm et al., 1998
), but do not rule out the possibility that some of the >15 known sialyltransferases (Tsuji, 1996
) may distinguish between natural and synthetic precursors, resulting in differential incorporation into different specific sialic acid glycoforms. Our data are consistent with prior reports of modified sialic acid incorporation into glycolipids (Kayser et al., 1992b
) and glycoproteins (Keppler et al., 1995
), but conflict with a recent report indicating no incorporation of NeuPr into gangliosides in ManNPr-treated neural cells (Schmidt et al., 1998
). This issue is worthy of further study to determine the basis for differences in precursor utilization.
As with other N-acylmannosamine precursors, treatment with ManNGc (as the monoacetate or pentaacetate) led NG10815 cells to synthesize and incorporate NeuGc, a major sialic acid found in non-neural tissues of many nonhuman species. Our testing of peracetylation to enhance uptake and anabolic utilization of carbohydrates was based on the work of Sarkar et al. (Sarkar et al., 1995
, 1997). As in their system, peracetylation greatly increased utilization, and this simple modification is likely to be useful for other synthetic sialic acid precursors. It is assumed that the peracetylated species enter the cells more rapidly, where they are fully de-O-acetylated (perhaps by nonspecific esterases) prior to or concurrent with their conversion to the corresponding sialic acids, as shown in Figure 5.
The demonstration that ManNGcPA is an effective NeuGc precursor, and that conversion of neural NeuAc to NeuGc abrogates MAG binding (Figures 8, 9), opens the way for future animal testing. A prior study showed little incorporation of intraperitoneally injected ManNPr into sialic acids in the brains of rats, even though it was incorporated into liver and serum glycoproteins (Kayser et al., 1992a
). It is hoped that peracetylation, or modification of the route of delivery, will result in higher nervous system conversion from NeuAc to NeuGc using ManNGcPA.
Animals which express NeuGc as a major sialic acid outside of the nervous system express only minor amounts within the nervous system (Chou et al., 1998
; Mikami et al., 1998
). Although the mechanism of NeuGc exclusion in the brain has yet to be determined, we demonstrate that cultured rodent neural cells readily convert ManNGcPA to NeuGc, which is effectively incorporated into both gangliosides and sialoglycoproteins.
| Materials and methods |
|---|
|
|
|---|
Mannosamine precursors and sialic acid derivatives
D-MannosamineHCl, ManNAc, NeuAc, and NeuGc were purchased from Sigma Chemical Co. (St. Louis). N-Glycolylmannosamine monoacetate (ManNGcMA, Figure 1) was synthesized using the method of Kuboki et al. (Kuboki et al., 1997
N-Glycolylmannosamine pentaacetate (ManNGcPA) was prepared by treating ManNGcMA (0.3 g) with acetic anhydride (2 ml) in pyridine (2 ml) for 1 h at ambient temperature. The reaction was monitored by silica gel thin layer chromatography, using toluene-ethanol (10:1) as the developing solvent and orcinol-sulfuric acid reagent to visualize sugars (product Rf = 0.32). The reaction mixture was concentrated and the product purified by silica gel column chromatography using step-wise elution with toluene, toluene-ethanol (50:1), and toluene-ethanol (20:1) as the eluants. Fractions containing the desired product were evaporated, resuspended in DMSO and the concentration determined by quantitative high pressure liquid chromatography. The structure of the peracetylated compound was confirmed by 1H NMR, which revealed full O-acetylation and an
:ß ratio of 2:1.
N-Propanoylmannosamine (ManNPr) was synthesized according to the method of Keppler et al. (Keppler et al., 1995
). D-MannosamineHCl (3 mmol), sodium methoxide (3.3 mmol), and propionic anhydride (3.6 mmol) in 300 ml of methanol were stirred for 2 h at 0°C. The desired product was isolated by silica gel column chromatography using ethyl acetatemethanolwater (5:2:1) as the eluant. Fractions were analyzed by thin layer chromatography using the same solvent for development and orcinol-sulfuric acid reagent for detection (Rf = 0.59). Fractions containing product were combined, evaporated to dryness, the residue dissolved in water, and stored at -20°C. N-Propanoylneuraminic acid (NeuPr) standard was prepared enzymatically (Comb and Roseman, 1960
) by reacting ManNPr with pyruvate using N-acetylneuraminic acid aldolase (Sigma).
Cell culture and treatment with sialic acid precursors
NG10815 cells were maintained in Dulbeccos modified Eagles medium (high glucose formulation) containing 5% iron-enriched calf serum, 100 µM hypoxanthine, 16 µM thymidine, and 5 µM aminopterin. Cells were cultured at 37°C in a humidified atmosphere of 90% air/10% CO2. For treatment with sialic acid precursors, mannosamine derivatives were diluted into the appropriate medium and filter sterilized. The growth medium was then replaced and cells were cultured in the presence of the precursor for 24144 h. In experiments testing ManNGcPA, all cells (control and experimental) were grown in the presence of 0.5% (v/v) DMSO, the carrier for ManNGcPA.
Sialic acid analyses
Cells were harvested using hypertonic Ca2+- and Mg2+-free phosphate-buffered saline containing 1 mM EDTA (Yang et al., 1996a
), collected by centrifugation, and homogenized in ice-cold water using a Potter-Elvehjem glass/Teflon homogenizer. Methanol (2.6 volumes) was added, the suspension was mixed and brought to ambient temperature, and then chloroform (1.3 volumes, based on the original homogenate) was added and the suspension mixed vigorously. The suspension was centrifuged 30 min at 2000 x g. After collecting the supernatant, the pellet (containing precipitated proteins) was resuspended in water or concentrated ammonium hydroxide and a portion was used for protein assay (BCA, Pierce, Rockford, IL). The supernatant was partitioned by adjusting the chloroformmethanolwater ratio to 4:8:5.6 by addition of water, mixing thoroughly, and centrifuging as above. The upper phase was collected and a portion was subjected to reverse phase chromatography, using Sep-Pak C18 cartridges (Waters, Milford, MA), to isolate gangliosides (Schnaar, 1994
).
To quantify and identify sialic acids, a portion of resolublized protein, organic/aqueous soluble pool, or reverse-phase purified gangliosides was evaporated to dryness in a 500-µl polypropylene tube and 20 µl of 0.1 M HCl/0.25 M NaCl was added. One Ampliwax bead (Perkin Elmer Corp, Foster City, CA) per reaction was added to block evaporation, and the sample hydrolyzed for 3 h at 80°C. Released sialic acids were analyzed by injecting an aliquot (110 µl) onto a Dionex high pressure liquid chromatography system (Dionex Corporation, Sunnyvale, CA) using a HPIC-AS6 column and a pulsed amperometric detector (Manzi et al., 1990
). Elution solutions were: A, 0.75 mM NaOH; B, 200 mM NaOH; and C, 400 mM sodium acetate in 50 mM NaOH. NeuAc and NeuPr were resolved by elution with 40% A, 50% B, 10% C for 15 min at 1 ml/min. NeuGc was resolved in separate injections using step gradient elution: 01.8 min, 18% A, 50% B, 32% C; 210 min, 40% B, 60% C. Sialic acids were identified by comparison of their elution time with those of standard NeuAc, NeuPr and NeuGc and were quantified in comparison to a standard curve of commercial NeuAc (for NeuAc and NeuPr) or NeuGc.
To confirm that the quantified peaks represented sialic acids, 10 µl of acid hydrolysates were treated with 1 µl of 1 M sodium phosphate (pH 7.2) and 10 µl of 0.1 M NaOH. Neutralized samples were incubated at 37°C for 2 h with or without 0.9 U of N-acetylneuraminic acid aldolase (Sigma), 32 µM NADH and 0.1 µg lactate dehydrogenase. Enzyme-dependent disappearance of the presumed sialic acid peak (Comb and Roseman, 1960
; Manzi et al., 1990
) was taken as evidence for its identity (data not shown). Sialic acid content in the ganglioside and glycoprotein fractions is expressed per milligram of total cell protein. Precursor pool sialic acid (sialic acid plus CMP-sialic acid) was calculated by subtracting the ganglioside value from the organic/aqueous pool value, both expressed per milligram of cell protein.
MAG binding
Flow cytometry was used to test binding of a soluble MAG-Fc chimera to precursor-treated and control NG10815 cells. A chimeric protein consisting of the entire extracellular domain of MAG fused via a three amino acid bridge (TGK) to the human Fc domain was produced using the "pIgPlus" vector (Novagen, Madison, WI). A PCR fragment coding for the extracellular domain of MAG was prepared using MAG in pCDM8 as template (Yang et al., 1996a
), the T7 5' primer (TAATACGACTCACTATAGG) and GATCGGATCCTTACCTGTTTTGGCCCACATCAGTCGGTGTGC as the 3' primer. The fragment was cut with BamH1 and HindIII and directionally cloned into the pIgPlus vector. The resulting construct was sequenced to confirm its identity, transfected into COS cells, and the resulting MAG-Fc chimera was purified from the culture medium using Protein G affinity chromatography.
For MAG binding studies, NG10815 cells were cultured in the presence of sialic acid precursors for the indicated times, then were released from culture dishes using hypertonic Ca2+/Mg2+-free phosphate-buffered saline (Yang et al., 1996a
) and resuspended (at 2 x 105 cells/ml) in 25 mM Hepes-buffered Hanks balanced salt solution (Bashor, 1979
) containing 5 mg/ml bovine serum albumin. MAG-Fc (6 µg) was added to 100 µl of the same buffer containing 6 µg fluorescein isothiocyanate-labeled goat anti-human Fc (Jackson Immunoresearch, West Grove, PA) and incubated on ice for 1 h 45 min with frequent mixing. Cell suspension (100 µl containing 50,000 cells) was added to the premixed antibody solution and the mixture incubated on ice for 45 min. The cells were then centrifuged for 4 sec at 16,000 x g and washed three times by resuspension in 200 µl of buffer with bovine serum albumin and centrifugation. The resulting cell pellet was resuspended in 100 µl buffer with bovine serum albumin and flow cytometry was performed on an Epics Profile II cytometer (Coulter Corp, Hialeah, FL).
| Acknowledgments |
|---|
|
|
|---|
We are grateful to Erich Boger and Susan Fromholt for expressing and purifying MAG-Fc, and to Masayuki Izumi for facilitating NMR analysis. This work was supported in part by grants from the National Institutes of Health (NS37096), the National Science Foundation (IBN-9631745), the National Multiple Sclerosis Society, and the Paralyzed Veterans of America Spinal Cord Research Foundation. T.J.F. was supported in part by a Howard Hughes Summer Research Fellowship and a Johns Hopkins University Provosts Undergraduate Research Award, B.E.C. was supported in part by National Institutes of Health Training Grant GM07626, and S.I. was supported by the Japan Society for the Promotion of Science.
| Abbreviations |
|---|
|
|
|---|
NeuAc, N-acetylneuraminic acid; MAG, myelin-associated glycoprotein; ManNAc, N-acetylmannosamine; ManNGc, N-glycolylmannosamine; ManNGcMA, N-glycolylmannosamine monoacetate; ManNGcPA, N-glycolylmannosamine pentaacetate; ManNPr, N-propanoylmannosamine; NeuGc, N-glycolylneuraminic acid; NeuPr, N-propanoylneuraminic acid.
| Footnotes |
|---|
1 These two authors contributed equally to this work.
2 Present address: Department of Molecular Biology, The Scripps Research Institute, La Jolla, CA ![]()
3 To whom correspondence should be addressed at: Department of Pharmacology and Molecular Sciences, The Johns Hopkins School of Medicine, 725 North Wolfe Street, Baltimore, MD 21205-2185 ![]()
| References |
|---|
|
|
|---|
Angelino,N.J., Bernacki,R.J., Sharma,M., Dodson-Simmons,O. and Korytnyk,W. (1995) Versatile intermediates in the selective modification of the amino function of 2-amino-2-deoxy-D-mannopyranose and the 3-position of 2-acetamido-2-deoxy-D-mannose: potential membrane modifiers in neoplastic control. Carbohydr. Res., 276, 99115.[ISI][Medline]
Bartsch,S., Montag,D., Schachner,M. and Bartsch,U. (1997) Increased number of unmyelinated axons in optic nerves of adult mice deficient in the myelin-associated glycoprotein (MAG). Brain Res., 762, 231234.[ISI][Medline]
Bashor,M.M. (1979) Dispersion and disruption of tissues. Methods Enzymol., 58, 119131.[Medline]
Brandley,B.K., Kiso,M., Abbas,S., Nikrad,P., Srivasatava,O., Foxall,C., Oda,Y. and Hasegawa,A. (1993) Structurefunction studies on selectin carbohydrate ligands. Modifications to fucose, sialic acid and sulphate as a sialic acid replacement. Glycobiology, 3, 633639.
Chou,H.H., Takematsu,H., Diaz,S., Iber,J., Nickerson,E., Wright,K.L., Muchmore,E.A., Nelson,D.L., Warren,S.T. and Varki,A. (1998) A mutation in human CMP-sialic acid hydroxylase occurred after the Homo-Pan divergence. Proc. Natl. Acad. Sci. USA, 95, 1175111756.
Collins,B.E., Yang,L.J.S., Mukhopadhyay,G., Filbin,M.T., Kiso,M., Hasegawa,A. and Schnaar,R.L. (1997a) Sialic acid specificity of myelin-associated glycoprotein binding. J. Biol. Chem., 272, 12481255.
Collins,B.E., Kiso,M., Hasegawa,A., Tropak,M.B., Roder,J.C., Crocker,P.R. and Schnaar,R.L. (1997b) Binding specificities of the sialoadhesin family of I-type lectins. Sialic acid linkage and substructure requirements for binding of myelin-associated glycoprotein, Schwann cell myelin protein and sialoadhesin. J. Biol. Chem., 272, 1688916895.
Comb,D.G. and Roseman,S. (1960) The sialic acids. I. The structure and enzymatic synthesis of N-acetylneuraminic acid. J. Biol. Chem., 235, 25292537.
Crocker,P.R., Clark,E.A., Filbin,M., Gordon,S., Jones,Y., Kehrl,J.H., Kelm,S., Le Douarin,N., Powell,L., Roder,J., Schnaar,R.L., Sgroi,D.C., Stamenkovic,K., Schauer,R., Schachner,M., van den Berg,T.K., van der Merwe,P.A., Watt,S.M. and Varki,A. (1998) Siglecs: a family of sialic-acid binding lectins. Glycobiology, 8(2), v.
Fruttiger,M., Montag,D., Schachner,M. and Martini,R. (1995) Crucial role for the myelin-associated glycoprotein in the maintenance of axonmyelin integrity. Eur. J. Neurosci., 7, 511515.[ISI][Medline]
Hamprecht,B. (1977) Structural, electrophysiological, biochemical and pharmacological properties of neuroblastomaglioma cell hybrids in culture. Int. Rev. Cytol., 49, 99170.[Medline]
Hardy,M.R., Townsend,R.R. and Lee,Y.C. (1988) Monosaccharide analysis of glycoconjugates by anion exchange chromatography with pulsed amperometric detection. Anal. Biochem., 170, 5462.[ISI][Medline]
Herrmann,M., von der Lieth,CW., Stehling,P., Reutter,W. and Pawlita,M. (1997) Consequences of a subtle sialic acid modification on the murine polyomavirus receptor. J. Virol., 71, 59225931.[Abstract]
Higa,H.H. and Paulson,J.C. (1985) Sialylation of glycoprotein oligosaccharides with N-acetyl-, N-glycolyl- and N-O-diacetylneuraminic acids. J. Biol. Chem., 260, 88388849.
Hinderlich,S., Stäsche,R., Zeitler,R. and Reutter,W. (1997) A bifunctional enzyme catalyzes the first two steps in N-acetylneuraminic acid biosynthesis of rat liver. Purification and characterization of UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase. J. Biol. Chem., 272, 2431324318.
Holmgren,J. (1994) Receptors for cholera toxin and Escherichia coli heat-labile enterotoxin revisited. Prog. Brain Res., 101, 163177.
Kawano,T., Koyama,S., Takematsu,H., Kozutsumi,Y., Kawasaki,H., Kawashima,S., Kawasaki,T. and Suzuki,A. (1995) Molecular cloning of cytidine monophosphate-N-acetylneuraminic acid hydroxylase. Regulation of species- and tissue-specific expression of N-glycolylneuraminic acid. J. Biol. Chem., 270, 1645816463.
Kayser,H., Zeitler,R., Kannicht,C., Grunow,D., Nuck,R. and Reutter,W. (1992a) Biosynthesis of a nonphysiological sialic acid in different rat organs, using N-propanoyl-D-hexosamines as precursors. J. Biol. Chem., 267, 1693416938.
Kayser,H., Geilen,C.C., Paul,C., Zeitler,R. and Reutter,W. (1992b) Incorporation of N-acyl-2-amino-2-deoxy-hexoses into glycosphingolipids of the pheochromocytoma cell line PC 12. FEBS Lett., 301, 137140.[ISI][Medline]
Kean,E.L. and Roseman,S. (1966) The sialic acids. X. Purification and properties of cytidine 5'-monophosphosialic acid synthetase. J. Biol. Chem., 241, 56435650.
Kelm,S., Pelz,A., Schauer,R., Filbin,M.T., Song,T., de Bellard,M.E., Schnaar,R.L., Mahoney,J.A., Hartnell,A., Bradfield,P. and Crocker,P.R. (1994a) Sialoadhesin, myelin-associated glycoprotein and CD22 define a new family of sialic acid-dependent adhesion molecules of the immunoglobulin superfamily. Curr. Biol., 4, 965972.[ISI][Medline]
Kelm,S., Schauer,R., Manuguerra,J.-C., Gross,H.-J. and Crocker,P.R. (1994b) Modifications of cell surface sialic acids modulate cell adhesion mediated by sialoadhesin and CD22. Glycoconj. J., 11, 576585.[ISI][Medline]
Kelm,S., Schauer,R. and Crocker,P.R. (1996) The sialoadhesinsa family of sialic acid-dependent cellular recognition molecules within the immunoglobulin superfamily. Glycoconj. J., 13, 913926.[ISI][Medline]
Kelm,S., Brossmer,R., Isecke,R., Gross,H.-J., Strenge,K. and Schauer,R. (1998) Functional groups of sialic acids involved in binding to siglecs (sialoadhesins) deduced from interactions with synthetic analogues. Eur. J. Biochem., 255, 663672.[ISI][Medline]
Keppler,O.T., Stehling,P., Herrmann,M., Kayser,H., Grunow,D., Reutter,W. and Pawlita,M. (1995) Biosynthetic modulation of sialic acid-dependent virus-receptor interactions of two primate polyoma viruses. J. Biol. Chem., 270, 13081314.
Kuboki,A., Okazaki,H., Sugai,T. and Ohta,H. (1997) An expeditious route to N-glycolylneuraminic acid based on enzyme-catalyzed reaction. Tetrahedron, 53, 23872400.
Kundig,W., Ghosh,S. and Roseman,S. (1966) The sialic acids. VII. N-Acyl-D-mannosamine kinase from rat liver. J. Biol. Chem., 241, 56195626.
Lassmann,H., Bartsch,U., Montag,D. and Schachner,M. (1997) Dying-back oligodendrogliopathy: a late sequel of myelin-associated glycoprotein deficiency. Glia, 19, 104110.[ISI][Medline]
Mahal,L.K., Yarema,K.J. and Bertozzi,C.R. (1997) Engineering chemical reactivity on cell surfaces through oligosaccharide biosynthesis. Science, 276, 11251128.
Manzi,A.E., Diaz,S. and Varki,A. (1990) High-pressure liquid chromatography of sialic acids on a pellicular resin anion-exchange column with pulsed amperometric detection: a comparison with six other systems. Anal. Biochem., 188, 2032.[ISI][Medline]
May,A.P., Robinson,R.C., Vinson,M., Crocker,P.R. and Jones,E.Y. (1998) Crystal structure of the N-terminal domain of sialoadhesin in complex with 3' sialyllactose at 1.85 Å resolution. Mol. Cell, 1, 719728.[ISI][Medline]
McEver,R.P. (1997) Selectincarbohydrate interactions during inflammation and metastasis. Glycoconj. J., 14, 585591.[ISI][Medline]
McKerracher,L., David,S., Jackson,D.L., Kottis,V., Dunn,R.J. and Braun,P.E. (1994) Identification of myelin-associated glycoprotein as a major myelin-derived inhibitor of neurite growth. Neuron, 13, 805811.[ISI][Medline]
Mikami,T., Kashiwagi,M., Tsuchihashi,K., Daino,T., Akino,T. and Gasa,S. (1998) Further characterization of equine brain gangliosides: the presence of GM3 having N-glycolyl neuraminic acid in the central nervous system. J. Biochem. (Tokyo), 123, 487491.
Miller-Podraza,H., Bergstrom,J., Milh,M.A. and Karlsson,K.A. (1997) Recognition of glycoconjugates by Helicobacter pylori. Comparison of two sialic acid-dependent specificities based on haemagglutination and binding to human erythrocyte glycoconjugates. Glycoconj. J., 14, 467467.[ISI][Medline]
Mukhopadhyay,G., Doherty,P., Walsh,F.S., Crocker,P.R. and Filbin,M.T. (1994) A novel role for myelin-associated glycoprotein as an inhibitor of axonal regeneration. Neuron, 12, 757767.
Murphy,T.H., Schnaar,R.L., Coyle,J.T. and Sastre,A. (1988) Glutamate cytotoxicity in a neuronal cell line is blocked by membrane depolarization. Brain Res., 460, 155160.[ISI][Medline]
Nelson,P.G., Christian,C.N., Daniels,M.P., Henkart,M., Bullock,P., Mullinax,D. and Nirenberg,M. (1978) Formation of synapses between cells of a neuroblastomaxglioma hybrid clone and mouse myotubes. Brain Res., 147, 245259.[ISI][Medline]
Norgard,K.E., Han,H., Powell,L.D., Kriegler,M., Varki,A. and Varki,N.M. (1993) Enhanced interaction of L-selectin with the high endothelial venule ligand via selectively oxidized sialic acids. Proc. Natl, Acad. Sci. USA, 90, 10681072.
Powell,L.D., Jain,R.K., Matta,K.L., Sabesan,S. and Varki,A. (1995) Characterization of sialyloligosaccharide binding by recombinant soluble and native cell-associated CD22. Evidence for a minimal structural recognition motif and the potential importance of multisite binding. J. Biol. Chem., 270, 75237532.
Rogers,G.N., Herrler,G., Paulson,J.C. and Klenk,H.-D. (1986) Influenza C virus uses 9-O-acetyl-N-acetylneuraminic acid as a high affinity receptor determinant for attachment to cells. J. Biol. Chem., 261, 59475951.
Roseman,S. (1970) The synthesis of complex carbohydrates by multiglycosyltransferase systems and their potential function in intercellular adhesion. Chem. Phys. Lipids, 5, 270297.[ISI][Medline]
Sarkar,A.K., Fritz,T.A., Taylor,W.H. and Esko,J.D. (1995) Disaccharide uptake and priming in animal cells: inhibition of sialyl Lewis x by acetylated Gal beta 14GlcNAc beta-O-naphthalenemethanol. Proc. Natl. Acad. Sci. USA, 92, 33233327.
Sarkar,A.K., Rostand,K.S., Jain,R.K., Matta,K.L. and Esko,J.D. (1997) Fucosylation of disaccharide precursors of sialyl Lewis x inhibit selectin-mediated cell adhesion. J. Biol. Chem., 272, 2560825616.
Schauer,R. (1982) Chemistry, metabolism and biological functions of sialic acids. Adv. Carbohydr. Chem. Biochem., 40, 131234.[ISI][Medline]
Schauer,R. (1987) Analysis of sialic acids. Methods Enzymol., 138, 132161.[ISI][Medline]
Schäfer,M., Fruttiger,M., Montag,D., Schachner,M. and Martini,R. (1996) Disruption of the gene for the myelin-associated glycoprotein improves axonal regrowth along myelin in C57BL/Wlds mice. Neuron, 16, 11071113.[ISI][Medline]
Schengrund,C.-L., DasGupta,B.R. and Ringler,N.J. (1991) Binding of botulinum and tetanus neurotoxins to ganglioside GT1b and derivatives thereof. J. Neurochem., 57, 10241032.[ISI][Medline]
Schmidt,C., Stehling,P., Schnitzer,J., Reutter,W. and Horstkorte,R. (1998) Biochemical engineering of neural cell surfaces by the synthetic N-propanoyl-substituted neuraminic acid precursor. J. Biol. Chem., 273, 1914619152.
Schnaar,R.L. (1994) Isolation of glycosphingolipids. Methods Enzymol., 230, 348370.[ISI][Medline]
Schnaar,R.L. and Needham,L.K. (1994) Thin-layer chromatography of glycosphingolipids. Methods Enzymol., 230, 371389.[ISI][Medline]
Schnaar,R.L., Collins,B.E., Wright,L.P., Kiso,M., Tropak,M.B., Roder,J.C. and Crocker,P.R. (1998) Myelin-associated glycoprotein binding to gangliosides. Structural specificity and functional implications. Ann. NY Acad. Sci., 845, 92105.
Sharon,N. (1996) Carbohydrate-lectin interactions in infectious disease. Adv. Exp. Med. Biol., 408, 18.[Medline]
Sheikh,K.A., Sun,J., Liu,Y., Kawai,H., Crawford,T.O., Proia,R.L., Griffin,J.W. and Schnaar,R.L. (1999) Mice lacking complex gangliosides develop Wallerian degeneration and myelination defects. Proc. Natl. Acad. Sci. USA, 96, 75327537.
Sjoberg,E.R., Powell,L.D., Klein,A. and Varki,A. (1994) Natural ligands of the B cell adhesion molecules CD22ß can be masked by 9-O-acetylation of sialic acids. J. Cell Biol., 126, 549562.
Strenge,K., Schauer,R., Bovin,N., Hasegawa,A., Ishida,H., Kiso,M. and Kelm,S. (1998) Glycan specificity of myelin-associated glycoprotein and sialoadhesin deduced from interactions with synthetic oligosaccharides. Eur. J. Biochem., 258, 677685.[ISI][Medline]
Thomas,G.H., Scocca,J., Miller,C.S. and Reynolds,L.W. (1985) Accumulation of N-acetylneuraminic acid (sialic acid) in human fibroblasts cultured in the presence of N-acetylmannosamine. Biochim. Biophys. Acta, 846, 3743.[Medline]
Tsuji,S. (1996) Molecular cloning and functional analysis of sialyltransferases. J. Biochem. (Tokyo), 120, 113.
Tyrrell,D., James,P., Rao,N., Foxall,C., Abbas,S., Dasgupta,F., Nashed,N., Hasegawa,A., Kiso,M., Asa,D., Kidd,J. and Brandley,B.K. (1991) Structural requirements for the carbohydrate l








